Incidental Mutation 'R9310:Mical2'
ID 705473
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Name microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms 4921517J23Rik, Ebitein1, 5330438E18Rik, Micalcl
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.242) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 111825063-112012313 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111950920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 958 (K958R)
Ref Sequence ENSEMBL: ENSMUSP00000051163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]
AlphaFold Q8BML1
Q9D5U9
Predicted Effect probably benign
Transcript: ENSMUST00000037991
SMART Domains Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1e-8 PFAM
Pfam:FAD_binding_2 88 127 3.2e-6 PFAM
low complexity region 175 188 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
low complexity region 894 925 N/A INTRINSIC
LIM 979 1033 9.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050149
AA Change: K958R

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244
AA Change: K958R

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1.1e-8 PFAM
Pfam:FAD_binding_2 88 127 1.5e-6 PFAM
Pfam:Pyr_redox_2 88 259 1.3e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 9.91e-10 SMART
low complexity region 918 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144509
SMART Domains Protein: ENSMUSP00000123341
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
LIM 14 68 9.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215412
Predicted Effect probably benign
Transcript: ENSMUST00000216652
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 117,698,859 (GRCm39) I83V possibly damaging Het
Abcf1 G A 17: 36,272,621 (GRCm39) A288V probably null Het
Acer1 A T 17: 57,262,598 (GRCm39) V184D probably damaging Het
Apoh T C 11: 108,298,307 (GRCm39) probably null Het
Arid1a T C 4: 133,413,625 (GRCm39) Y959C unknown Het
Asb3 A T 11: 30,978,962 (GRCm39) H84L probably benign Het
Atxn1 A C 13: 45,721,494 (GRCm39) Y134D probably damaging Het
Btbd1 T C 7: 81,478,985 (GRCm39) Y52C probably damaging Het
Cabp2 A G 19: 4,136,464 (GRCm39) D170G probably damaging Het
Cacna1a C A 8: 85,263,046 (GRCm39) A407E probably damaging Het
Cacna2d4 T A 6: 119,248,914 (GRCm39) probably null Het
Cc2d2a T C 5: 43,852,488 (GRCm39) F404S probably damaging Het
Cdh20 T C 1: 104,875,061 (GRCm39) M281T probably damaging Het
Cfap54 A T 10: 92,798,177 (GRCm39) M1694K unknown Het
Chd6 G T 2: 160,881,181 (GRCm39) T261K probably damaging Het
Cnksr1 T C 4: 133,956,330 (GRCm39) S585G probably damaging Het
Cntnap2 A T 6: 45,978,281 (GRCm39) Y312F probably damaging Het
Coa7 T A 4: 108,195,510 (GRCm39) Y146* probably null Het
Col28a1 T C 6: 8,175,414 (GRCm39) K145E unknown Het
Coq8b T A 7: 26,941,486 (GRCm39) I221N probably damaging Het
Cpd A T 11: 76,705,607 (GRCm39) L375* probably null Het
Dnah5 T C 15: 28,448,579 (GRCm39) F4214S probably damaging Het
Dnai3 C T 3: 145,802,895 (GRCm39) probably null Het
Dock2 A G 11: 34,244,139 (GRCm39) F1067S possibly damaging Het
Dpp6 G A 5: 27,836,439 (GRCm39) A310T probably damaging Het
Dpp6 C A 5: 27,930,642 (GRCm39) L825I probably benign Het
Efcab5 A G 11: 77,004,531 (GRCm39) V929A probably benign Het
Ephx3 C G 17: 32,408,290 (GRCm39) D45H probably benign Het
Espl1 G A 15: 102,205,285 (GRCm39) probably null Het
Firrm A G 1: 163,792,089 (GRCm39) C610R probably damaging Het
Gm4847 T C 1: 166,460,281 (GRCm39) R402G probably benign Het
Grid1 T C 14: 34,748,762 (GRCm39) L194S probably damaging Het
Heatr1 A T 13: 12,453,491 (GRCm39) H2122L probably benign Het
Il17b T A 18: 61,825,334 (GRCm39) C123* probably null Het
Il17rc T C 6: 113,451,210 (GRCm39) L181P probably damaging Het
Inpp5e T A 2: 26,287,940 (GRCm39) I619L probably benign Het
Itgax C A 7: 127,741,432 (GRCm39) Y814* probably null Het
Marcks C T 10: 37,012,487 (GRCm39) E183K unknown Het
Mefv T C 16: 3,533,252 (GRCm39) T340A probably benign Het
Mrtfb T A 16: 13,218,954 (GRCm39) D533E probably benign Het
Mtor T A 4: 148,553,834 (GRCm39) L811Q probably benign Het
Myh4 A G 11: 67,145,570 (GRCm39) Y1351C probably damaging Het
Neb T C 2: 52,153,708 (GRCm39) M2406V probably benign Het
Nebl T C 2: 17,353,678 (GRCm39) T214A probably benign Het
Nlrx1 A T 9: 44,164,705 (GRCm39) I913N probably damaging Het
Npr2 G T 4: 43,632,404 (GRCm39) A74S probably benign Het
Or4c115 T A 2: 88,928,257 (GRCm39) S5C probably damaging Het
Or6b6 C A 7: 106,570,678 (GRCm39) C291F probably damaging Het
Or6c88 T A 10: 129,406,687 (GRCm39) N54K probably benign Het
Pard3b G T 1: 62,205,528 (GRCm39) V441F probably damaging Het
Pcsk1 G A 13: 75,238,191 (GRCm39) R4K probably benign Het
Pisd G T 5: 32,894,784 (GRCm39) N337K possibly damaging Het
Pml T C 9: 58,156,945 (GRCm39) K10R probably benign Het
Prkci T C 3: 31,083,664 (GRCm39) W132R probably damaging Het
Prrc2a A T 17: 35,374,975 (GRCm39) M1225K probably benign Het
Prss23 T C 7: 89,159,142 (GRCm39) D309G probably damaging Het
Pxdn G A 12: 30,052,051 (GRCm39) G743S probably damaging Het
Rab29 A T 1: 131,799,860 (GRCm39) E145V probably damaging Het
Rasef C T 4: 73,653,956 (GRCm39) probably null Het
Rcbtb1 T G 14: 59,472,699 (GRCm39) I496S probably benign Het
Rcor1 T C 12: 111,066,393 (GRCm39) Y228H Het
Reep5 C T 18: 34,490,222 (GRCm39) V92I probably damaging Het
Rfx3 T C 19: 27,827,329 (GRCm39) S86G probably benign Het
Rptn T A 3: 93,304,384 (GRCm39) D572E probably benign Het
Rsl1 A T 13: 67,324,510 (GRCm39) probably null Het
Sbf2 T C 7: 109,914,292 (GRCm39) E1630G possibly damaging Het
Sele G A 1: 163,876,975 (GRCm39) V84I probably benign Het
Serpina1b T C 12: 103,698,756 (GRCm39) D31G probably benign Het
Serpina3c T C 12: 104,115,813 (GRCm39) I244V probably benign Het
Serpinb6e A G 13: 34,017,204 (GRCm39) V272A probably benign Het
Serpinb9b A G 13: 33,219,523 (GRCm39) D150G probably benign Het
Sgpp1 T C 12: 75,769,374 (GRCm39) T265A probably benign Het
Slc9a1 T A 4: 133,143,681 (GRCm39) M389K probably damaging Het
Slco3a1 A T 7: 74,204,236 (GRCm39) C35S probably damaging Het
Slco6d1 T A 1: 98,427,619 (GRCm39) V650E possibly damaging Het
Slit2 T C 5: 48,349,568 (GRCm39) V274A possibly damaging Het
Snd1 A G 6: 28,795,936 (GRCm39) E593G probably null Het
Spata2l C T 8: 123,960,873 (GRCm39) V139M probably benign Het
Suco T C 1: 161,684,427 (GRCm39) K231R probably damaging Het
Tenm3 C A 8: 49,008,935 (GRCm39) probably benign Het
Tg T C 15: 66,699,118 (GRCm39) S2415P possibly damaging Het
Traf6 C A 2: 101,527,072 (GRCm39) A274D possibly damaging Het
Usp14 A G 18: 9,996,239 (GRCm39) I447T possibly damaging Het
Usp32 G A 11: 84,942,028 (GRCm39) L355F probably benign Het
Vcpip1 T C 1: 9,817,927 (GRCm39) N152S possibly damaging Het
Vgf A G 5: 137,061,110 (GRCm39) Q424R probably benign Het
Vmn2r84 A T 10: 130,227,993 (GRCm39) M81K possibly damaging Het
Washc5 G A 15: 59,218,067 (GRCm39) A732V possibly damaging Het
Xrcc3 T G 12: 111,771,485 (GRCm39) D213A probably damaging Het
Zeb2 T C 2: 44,886,988 (GRCm39) T690A probably benign Het
Zfat G A 15: 67,956,250 (GRCm39) S1212L probably damaging Het
Zfp623 C T 15: 75,819,949 (GRCm39) L302F probably damaging Het
Zfp799 A C 17: 33,039,733 (GRCm39) C178G possibly damaging Het
Zfy1 T C Y: 727,634 (GRCm39) E348G unknown Het
Zhx3 A G 2: 160,621,393 (GRCm39) W925R possibly damaging Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Mical2 APN 7 111,981,352 (GRCm39) missense possibly damaging 0.94
IGL00886:Mical2 APN 7 111,914,279 (GRCm39) missense probably benign 0.00
IGL00934:Mical2 APN 7 111,948,610 (GRCm39) missense probably damaging 1.00
IGL00941:Mical2 APN 7 111,920,652 (GRCm39) splice site probably benign
IGL01020:Mical2 APN 7 111,914,283 (GRCm39) splice site probably benign
IGL01395:Mical2 APN 7 111,922,792 (GRCm39) missense probably damaging 1.00
IGL01658:Mical2 APN 7 111,914,205 (GRCm39) missense probably damaging 1.00
IGL01775:Mical2 APN 7 111,981,269 (GRCm39) missense possibly damaging 0.89
IGL02040:Mical2 APN 7 111,910,613 (GRCm39) missense probably damaging 1.00
IGL02051:Mical2 APN 7 111,980,597 (GRCm39) missense probably benign 0.30
IGL02388:Mical2 APN 7 111,934,620 (GRCm39) missense probably benign
IGL02551:Mical2 APN 7 111,923,197 (GRCm39) missense probably benign 0.01
IGL02578:Mical2 APN 7 111,950,580 (GRCm39) missense probably benign 0.05
IGL02751:Mical2 APN 7 111,931,243 (GRCm39) missense probably benign 0.11
IGL03114:Mical2 APN 7 111,996,764 (GRCm39) missense probably damaging 1.00
R0091:Mical2 UTSW 7 111,980,503 (GRCm39) missense probably benign 0.05
R0101:Mical2 UTSW 7 111,936,074 (GRCm39) missense possibly damaging 0.86
R0415:Mical2 UTSW 7 111,980,235 (GRCm39) missense probably damaging 1.00
R0504:Mical2 UTSW 7 111,870,524 (GRCm39) missense probably benign 0.00
R0594:Mical2 UTSW 7 111,917,657 (GRCm39) missense probably damaging 0.97
R0609:Mical2 UTSW 7 111,920,647 (GRCm39) splice site probably null
R0962:Mical2 UTSW 7 111,979,624 (GRCm39) missense probably damaging 0.99
R1521:Mical2 UTSW 7 111,980,817 (GRCm39) missense probably damaging 1.00
R1542:Mical2 UTSW 7 111,908,675 (GRCm39) missense probably damaging 1.00
R1611:Mical2 UTSW 7 111,980,671 (GRCm39) missense probably damaging 0.99
R1740:Mical2 UTSW 7 111,933,043 (GRCm39) missense probably benign
R1815:Mical2 UTSW 7 112,012,109 (GRCm39) missense probably damaging 1.00
R1855:Mical2 UTSW 7 111,944,489 (GRCm39) missense probably benign 0.21
R1958:Mical2 UTSW 7 111,980,311 (GRCm39) missense probably benign 0.00
R1962:Mical2 UTSW 7 112,012,051 (GRCm39) missense probably benign 0.14
R2086:Mical2 UTSW 7 111,917,810 (GRCm39) missense probably benign 0.31
R2136:Mical2 UTSW 7 111,870,722 (GRCm39) missense possibly damaging 0.72
R2418:Mical2 UTSW 7 111,919,941 (GRCm39) critical splice donor site probably null
R2439:Mical2 UTSW 7 111,994,002 (GRCm39) missense probably damaging 0.99
R3053:Mical2 UTSW 7 111,910,630 (GRCm39) missense probably damaging 1.00
R3979:Mical2 UTSW 7 112,006,885 (GRCm39) splice site probably null
R4308:Mical2 UTSW 7 111,931,199 (GRCm39) missense probably benign 0.27
R4551:Mical2 UTSW 7 111,981,123 (GRCm39) missense possibly damaging 0.87
R4583:Mical2 UTSW 7 112,012,154 (GRCm39) missense probably benign 0.02
R4663:Mical2 UTSW 7 111,927,884 (GRCm39) missense possibly damaging 0.80
R4868:Mical2 UTSW 7 111,917,831 (GRCm39) missense probably damaging 1.00
R4902:Mical2 UTSW 7 111,936,107 (GRCm39) missense probably benign
R5112:Mical2 UTSW 7 111,919,818 (GRCm39) missense probably damaging 1.00
R5459:Mical2 UTSW 7 111,981,444 (GRCm39) missense probably benign 0.00
R5487:Mical2 UTSW 7 111,919,842 (GRCm39) missense probably damaging 1.00
R5563:Mical2 UTSW 7 111,914,185 (GRCm39) missense probably damaging 1.00
R5763:Mical2 UTSW 7 111,973,861 (GRCm39) critical splice donor site probably null
R5817:Mical2 UTSW 7 111,922,866 (GRCm39) missense probably benign
R5987:Mical2 UTSW 7 111,934,155 (GRCm39) missense probably benign 0.00
R6042:Mical2 UTSW 7 111,979,619 (GRCm39) missense probably benign 0.40
R6087:Mical2 UTSW 7 111,917,692 (GRCm39) nonsense probably null
R6189:Mical2 UTSW 7 112,012,087 (GRCm39) missense probably damaging 1.00
R6209:Mical2 UTSW 7 111,923,293 (GRCm39) splice site probably null
R6311:Mical2 UTSW 7 111,922,765 (GRCm39) missense probably damaging 1.00
R6319:Mical2 UTSW 7 111,927,884 (GRCm39) missense possibly damaging 0.80
R6578:Mical2 UTSW 7 111,910,652 (GRCm39) missense probably damaging 1.00
R6750:Mical2 UTSW 7 111,981,046 (GRCm39) missense probably damaging 0.98
R6782:Mical2 UTSW 7 111,945,968 (GRCm39) missense probably damaging 1.00
R6798:Mical2 UTSW 7 111,975,266 (GRCm39) utr 3 prime probably benign
R7061:Mical2 UTSW 7 111,946,008 (GRCm39) missense probably benign 0.10
R7147:Mical2 UTSW 7 111,922,810 (GRCm39) missense possibly damaging 0.77
R7260:Mical2 UTSW 7 111,919,001 (GRCm39) missense probably benign 0.10
R7266:Mical2 UTSW 7 111,902,963 (GRCm39) missense probably damaging 1.00
R7347:Mical2 UTSW 7 111,981,358 (GRCm39) missense probably benign 0.01
R7391:Mical2 UTSW 7 111,919,816 (GRCm39) missense probably damaging 1.00
R7724:Mical2 UTSW 7 111,922,833 (GRCm39) missense probably damaging 1.00
R7747:Mical2 UTSW 7 111,933,046 (GRCm39) missense probably benign 0.02
R7783:Mical2 UTSW 7 112,012,183 (GRCm39) missense probably damaging 1.00
R7818:Mical2 UTSW 7 111,944,514 (GRCm39) missense probably damaging 1.00
R7824:Mical2 UTSW 7 112,006,844 (GRCm39) missense probably damaging 1.00
R7995:Mical2 UTSW 7 111,980,975 (GRCm39) missense probably benign 0.31
R8022:Mical2 UTSW 7 111,902,974 (GRCm39) missense probably damaging 1.00
R8429:Mical2 UTSW 7 111,944,460 (GRCm39) missense probably benign 0.01
R8505:Mical2 UTSW 7 111,919,007 (GRCm39) missense probably benign 0.02
R8532:Mical2 UTSW 7 111,917,751 (GRCm39) missense probably damaging 1.00
R8830:Mical2 UTSW 7 111,980,403 (GRCm39) missense probably benign 0.01
R8862:Mical2 UTSW 7 111,910,574 (GRCm39) missense probably damaging 1.00
R8906:Mical2 UTSW 7 111,980,671 (GRCm39) missense probably damaging 0.99
R8988:Mical2 UTSW 7 111,910,661 (GRCm39) missense possibly damaging 0.63
R9006:Mical2 UTSW 7 111,981,323 (GRCm39) missense probably benign 0.13
R9123:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9127:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9128:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9129:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9140:Mical2 UTSW 7 112,006,826 (GRCm39) missense probably damaging 1.00
R9187:Mical2 UTSW 7 111,902,797 (GRCm39) nonsense probably null
R9233:Mical2 UTSW 7 111,981,399 (GRCm39) missense probably benign 0.05
R9304:Mical2 UTSW 7 111,980,974 (GRCm39) missense probably damaging 0.97
R9377:Mical2 UTSW 7 111,981,246 (GRCm39) missense probably benign 0.10
R9399:Mical2 UTSW 7 111,946,082 (GRCm39) missense probably damaging 1.00
R9457:Mical2 UTSW 7 112,010,665 (GRCm39) missense probably damaging 0.96
R9500:Mical2 UTSW 7 111,936,054 (GRCm39) critical splice acceptor site probably null
R9620:Mical2 UTSW 7 111,980,403 (GRCm39) missense probably benign 0.01
R9652:Mical2 UTSW 7 111,945,996 (GRCm39) missense probably damaging 1.00
R9657:Mical2 UTSW 7 111,921,806 (GRCm39) missense probably benign 0.37
R9756:Mical2 UTSW 7 111,902,928 (GRCm39) missense probably damaging 0.99
R9789:Mical2 UTSW 7 111,945,996 (GRCm39) missense probably damaging 1.00
RF008:Mical2 UTSW 7 111,922,833 (GRCm39) missense probably damaging 1.00
X0062:Mical2 UTSW 7 111,946,050 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAAGAGGCCTGCTCAAC -3'
(R):5'- ATGAAGAGATACTCAACCCTGTC -3'

Sequencing Primer
(F):5'- CTTAGGTGGATGCAGGGACTCC -3'
(R):5'- CCTGTCAAAGTCAGGCAGAAGTG -3'
Posted On 2022-03-25