Mutagenetix > Incidental Mutation

Incidental Mutation 'R9310:Cfap54'

705482

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R9310 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92962315 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1694 (M1694K)

Ref Sequence

ENSEMBL: ENSMUSP00000148636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000168110
AA Change: M1694K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: M1694K

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000212902
AA Change: M1694K

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030J22Rik	T	C	8: 116,972,120	I83V	possibly damaging	Het
Abcf1	G	A	17: 35,961,729	A288V	probably null	Het
Acer1	A	T	17: 56,955,598	V184D	probably damaging	Het
Apoh	T	C	11: 108,407,481		probably null	Het
Arid1a	T	C	4: 133,686,314	Y959C	unknown	Het
Asb3	A	T	11: 31,028,962	H84L	probably benign	Het
Atxn1	A	C	13: 45,568,018	Y134D	probably damaging	Het
BC055324	A	G	1: 163,964,520	C610R	probably damaging	Het
Btbd1	T	C	7: 81,829,237	Y52C	probably damaging	Het
Cabp2	A	G	19: 4,086,464	D170G	probably damaging	Het
Cacna1a	C	A	8: 84,536,417	A407E	probably damaging	Het
Cacna2d4	T	A	6: 119,271,953		probably null	Het
Cc2d2a	T	C	5: 43,695,146	F404S	probably damaging	Het
Cdh20	T	C	1: 104,947,336	M281T	probably damaging	Het
Chd6	G	T	2: 161,039,261	T261K	probably damaging	Het
Cnksr1	T	C	4: 134,229,019	S585G	probably damaging	Het
Cntnap2	A	T	6: 46,001,347	Y312F	probably damaging	Het
Coa7	T	A	4: 108,338,313	Y146*	probably null	Het
Col28a1	T	C	6: 8,175,414	K145E	unknown	Het
Coq8b	T	A	7: 27,242,061	I221N	probably damaging	Het
Cpd	A	T	11: 76,814,781	L375*	probably null	Het
Dnah5	T	C	15: 28,448,433	F4214S	probably damaging	Het
Dock2	A	G	11: 34,294,139	F1067S	possibly damaging	Het
Dpp6	G	A	5: 27,631,441	A310T	probably damaging	Het
Dpp6	C	A	5: 27,725,644	L825I	probably benign	Het
Efcab5	A	G	11: 77,113,705	V929A	probably benign	Het
Ephx3	C	G	17: 32,189,316	D45H	probably benign	Het
Espl1	G	A	15: 102,296,850		probably null	Het
Gm4847	T	C	1: 166,632,712	R402G	probably benign	Het
Grid1	T	C	14: 35,026,805	L194S	probably damaging	Het
Heatr1	A	T	13: 12,438,610	H2122L	probably benign	Het
Il17b	T	A	18: 61,692,263	C123*	probably null	Het
Il17rc	T	C	6: 113,474,249	L181P	probably damaging	Het
Inpp5e	T	A	2: 26,397,928	I619L	probably benign	Het
Itgax	C	A	7: 128,142,260	Y814*	probably null	Het
Marcks	C	T	10: 37,136,491	E183K	unknown	Het
Mefv	T	C	16: 3,715,388	T340A	probably benign	Het
Mical2	A	G	7: 112,351,713	K958R	probably benign	Het
Mkl2	T	A	16: 13,401,090	D533E	probably benign	Het
Mtor	T	A	4: 148,469,377	L811Q	probably benign	Het
Myh4	A	G	11: 67,254,744	Y1351C	probably damaging	Het
Neb	T	C	2: 52,263,696	M2406V	probably benign	Het
Nebl	T	C	2: 17,348,867	T214A	probably benign	Het
Nlrx1	A	T	9: 44,253,408	I913N	probably damaging	Het
Npr2	G	T	4: 43,632,404	A74S	probably benign	Het
Olfr1220	T	A	2: 89,097,913	S5C	probably damaging	Het
Olfr711	C	A	7: 106,971,471	C291F	probably damaging	Het
Olfr794	T	A	10: 129,570,818	N54K	probably benign	Het
Pard3b	G	T	1: 62,166,369	V441F	probably damaging	Het
Pcsk1	G	A	13: 75,090,072	R4K	probably benign	Het
Pisd	G	T	5: 32,737,440	N337K	possibly damaging	Het
Pml	T	C	9: 58,249,662	K10R	probably benign	Het
Prkci	T	C	3: 31,029,515	W132R	probably damaging	Het
Prrc2a	A	T	17: 35,155,999	M1225K	probably benign	Het
Prss23	T	C	7: 89,509,934	D309G	probably damaging	Het
Pxdn	G	A	12: 30,002,052	G743S	probably damaging	Het
Rab29	A	T	1: 131,872,122	E145V	probably damaging	Het
Rasef	C	T	4: 73,735,719		probably null	Het
Rcbtb1	T	G	14: 59,235,250	I496S	probably benign	Het
Rcor1	T	C	12: 111,099,959	Y228H		Het
Reep5	C	T	18: 34,357,169	V92I	probably damaging	Het
Rfx3	T	C	19: 27,849,929	S86G	probably benign	Het
Rptn	T	A	3: 93,397,077	D572E	probably benign	Het
Rsl1	A	T	13: 67,176,446		probably null	Het
Sbf2	T	C	7: 110,315,085	E1630G	possibly damaging	Het
Sele	G	A	1: 164,049,406	V84I	probably benign	Het
Serpina1b	T	C	12: 103,732,497	D31G	probably benign	Het
Serpina3c	T	C	12: 104,149,554	I244V	probably benign	Het
Serpinb6e	A	G	13: 33,833,221	V272A	probably benign	Het
Serpinb9b	A	G	13: 33,035,540	D150G	probably benign	Het
Sgpp1	T	C	12: 75,722,600	T265A	probably benign	Het
Slc9a1	T	A	4: 133,416,370	M389K	probably damaging	Het
Slco3a1	A	T	7: 74,554,488	C35S	probably damaging	Het
Slco6d1	T	A	1: 98,499,894	V650E	possibly damaging	Het
Slit2	T	C	5: 48,192,226	V274A	possibly damaging	Het
Snd1	A	G	6: 28,795,937	E593G	probably null	Het
Spata2l	C	T	8: 123,234,134	V139M	probably benign	Het
Suco	T	C	1: 161,856,858	K231R	probably damaging	Het
Tenm3	C	A	8: 48,555,900		probably benign	Het
Tg	T	C	15: 66,827,269	S2415P	possibly damaging	Het
Traf6	C	A	2: 101,696,727	A274D	possibly damaging	Het
Usp14	A	G	18: 9,996,239	I447T	possibly damaging	Het
Usp32	G	A	11: 85,051,202	L355F	probably benign	Het
Vcpip1	T	C	1: 9,747,702	N152S	possibly damaging	Het
Vgf	A	G	5: 137,032,256	Q424R	probably benign	Het
Vmn2r84	A	T	10: 130,392,124	M81K	possibly damaging	Het
Washc5	G	A	15: 59,346,218	A732V	possibly damaging	Het
Wdr63	C	T	3: 146,097,140		probably null	Het
Xrcc3	T	G	12: 111,805,051	D213A	probably damaging	Het
Zeb2	T	C	2: 44,996,976	T690A	probably benign	Het
Zfat	G	A	15: 68,084,401	S1212L	probably damaging	Het
Zfp623	C	T	15: 75,948,100	L302F	probably damaging	Het
Zfp799	A	C	17: 32,820,759	C178G	possibly damaging	Het
Zfy1	T	C	Y: 727,634	E348G	unknown	Het
Zhx3	A	G	2: 160,779,473	W925R	possibly damaging	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0194:Cfap54	UTSW	10	93034662	unclassified	probably benign
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1756:Cfap54	UTSW	10	93048061	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R1958:Cfap54	UTSW	10	92997342	missense	probably benign	0.18
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2059:Cfap54	UTSW	10	92942979	unclassified	probably benign
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4714:Cfap54	UTSW	10	92815918	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4776:Cfap54	UTSW	10	92972694	missense	possibly damaging	0.96
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R4965:Cfap54	UTSW	10	93066799	missense	probably benign	0.23
R5001:Cfap54	UTSW	10	92964534	missense	probably benign	0.01
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5256:Cfap54	UTSW	10	93045023	splice site	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5586:Cfap54	UTSW	10	92972611	nonsense	probably null
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9258:Cfap54	UTSW	10	92935098	missense	unknown
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGACAGTAAGGGTTTCTATCTC -3'
(R):5'- TGGTGGCTACTGGACTCTAC -3'

Sequencing Primer
(F):5'- TCAAACAAACTGGATTTTCAGGC -3'
(R):5'- GCTACTGGACTCTACTGCAGAATTG -3'

Posted On

2022-03-25