Incidental Mutation 'R9310:Dock2'
ID 705486
Institutional Source Beutler Lab
Gene Symbol Dock2
Ensembl Gene ENSMUSG00000020143
Gene Name dedicator of cyto-kinesis 2
Synonyms CED-5, Hch, MBC
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 34176815-34674719 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34244139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1067 (F1067S)
Ref Sequence ENSEMBL: ENSMUSP00000090884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093193] [ENSMUST00000101365]
AlphaFold Q8C3J5
Predicted Effect possibly damaging
Transcript: ENSMUST00000093193
AA Change: F1067S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143
AA Change: F1067S

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101365
AA Change: F1067S

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143
AA Change: F1067S

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 117,698,859 (GRCm39) I83V possibly damaging Het
Abcf1 G A 17: 36,272,621 (GRCm39) A288V probably null Het
Acer1 A T 17: 57,262,598 (GRCm39) V184D probably damaging Het
Apoh T C 11: 108,298,307 (GRCm39) probably null Het
Arid1a T C 4: 133,413,625 (GRCm39) Y959C unknown Het
Asb3 A T 11: 30,978,962 (GRCm39) H84L probably benign Het
Atxn1 A C 13: 45,721,494 (GRCm39) Y134D probably damaging Het
Btbd1 T C 7: 81,478,985 (GRCm39) Y52C probably damaging Het
Cabp2 A G 19: 4,136,464 (GRCm39) D170G probably damaging Het
Cacna1a C A 8: 85,263,046 (GRCm39) A407E probably damaging Het
Cacna2d4 T A 6: 119,248,914 (GRCm39) probably null Het
Cc2d2a T C 5: 43,852,488 (GRCm39) F404S probably damaging Het
Cdh20 T C 1: 104,875,061 (GRCm39) M281T probably damaging Het
Cfap54 A T 10: 92,798,177 (GRCm39) M1694K unknown Het
Chd6 G T 2: 160,881,181 (GRCm39) T261K probably damaging Het
Cnksr1 T C 4: 133,956,330 (GRCm39) S585G probably damaging Het
Cntnap2 A T 6: 45,978,281 (GRCm39) Y312F probably damaging Het
Coa7 T A 4: 108,195,510 (GRCm39) Y146* probably null Het
Col28a1 T C 6: 8,175,414 (GRCm39) K145E unknown Het
Coq8b T A 7: 26,941,486 (GRCm39) I221N probably damaging Het
Cpd A T 11: 76,705,607 (GRCm39) L375* probably null Het
Dnah5 T C 15: 28,448,579 (GRCm39) F4214S probably damaging Het
Dnai3 C T 3: 145,802,895 (GRCm39) probably null Het
Dpp6 G A 5: 27,836,439 (GRCm39) A310T probably damaging Het
Dpp6 C A 5: 27,930,642 (GRCm39) L825I probably benign Het
Efcab5 A G 11: 77,004,531 (GRCm39) V929A probably benign Het
Ephx3 C G 17: 32,408,290 (GRCm39) D45H probably benign Het
Espl1 G A 15: 102,205,285 (GRCm39) probably null Het
Firrm A G 1: 163,792,089 (GRCm39) C610R probably damaging Het
Gm4847 T C 1: 166,460,281 (GRCm39) R402G probably benign Het
Grid1 T C 14: 34,748,762 (GRCm39) L194S probably damaging Het
Heatr1 A T 13: 12,453,491 (GRCm39) H2122L probably benign Het
Il17b T A 18: 61,825,334 (GRCm39) C123* probably null Het
Il17rc T C 6: 113,451,210 (GRCm39) L181P probably damaging Het
Inpp5e T A 2: 26,287,940 (GRCm39) I619L probably benign Het
Itgax C A 7: 127,741,432 (GRCm39) Y814* probably null Het
Marcks C T 10: 37,012,487 (GRCm39) E183K unknown Het
Mefv T C 16: 3,533,252 (GRCm39) T340A probably benign Het
Mical2 A G 7: 111,950,920 (GRCm39) K958R probably benign Het
Mrtfb T A 16: 13,218,954 (GRCm39) D533E probably benign Het
Mtor T A 4: 148,553,834 (GRCm39) L811Q probably benign Het
Myh4 A G 11: 67,145,570 (GRCm39) Y1351C probably damaging Het
Neb T C 2: 52,153,708 (GRCm39) M2406V probably benign Het
Nebl T C 2: 17,353,678 (GRCm39) T214A probably benign Het
Nlrx1 A T 9: 44,164,705 (GRCm39) I913N probably damaging Het
Npr2 G T 4: 43,632,404 (GRCm39) A74S probably benign Het
Or4c115 T A 2: 88,928,257 (GRCm39) S5C probably damaging Het
Or6b6 C A 7: 106,570,678 (GRCm39) C291F probably damaging Het
Or6c88 T A 10: 129,406,687 (GRCm39) N54K probably benign Het
Pard3b G T 1: 62,205,528 (GRCm39) V441F probably damaging Het
Pcsk1 G A 13: 75,238,191 (GRCm39) R4K probably benign Het
Pisd G T 5: 32,894,784 (GRCm39) N337K possibly damaging Het
Pml T C 9: 58,156,945 (GRCm39) K10R probably benign Het
Prkci T C 3: 31,083,664 (GRCm39) W132R probably damaging Het
Prrc2a A T 17: 35,374,975 (GRCm39) M1225K probably benign Het
Prss23 T C 7: 89,159,142 (GRCm39) D309G probably damaging Het
Pxdn G A 12: 30,052,051 (GRCm39) G743S probably damaging Het
Rab29 A T 1: 131,799,860 (GRCm39) E145V probably damaging Het
Rasef C T 4: 73,653,956 (GRCm39) probably null Het
Rcbtb1 T G 14: 59,472,699 (GRCm39) I496S probably benign Het
Rcor1 T C 12: 111,066,393 (GRCm39) Y228H Het
Reep5 C T 18: 34,490,222 (GRCm39) V92I probably damaging Het
Rfx3 T C 19: 27,827,329 (GRCm39) S86G probably benign Het
Rptn T A 3: 93,304,384 (GRCm39) D572E probably benign Het
Rsl1 A T 13: 67,324,510 (GRCm39) probably null Het
Sbf2 T C 7: 109,914,292 (GRCm39) E1630G possibly damaging Het
Sele G A 1: 163,876,975 (GRCm39) V84I probably benign Het
Serpina1b T C 12: 103,698,756 (GRCm39) D31G probably benign Het
Serpina3c T C 12: 104,115,813 (GRCm39) I244V probably benign Het
Serpinb6e A G 13: 34,017,204 (GRCm39) V272A probably benign Het
Serpinb9b A G 13: 33,219,523 (GRCm39) D150G probably benign Het
Sgpp1 T C 12: 75,769,374 (GRCm39) T265A probably benign Het
Slc9a1 T A 4: 133,143,681 (GRCm39) M389K probably damaging Het
Slco3a1 A T 7: 74,204,236 (GRCm39) C35S probably damaging Het
Slco6d1 T A 1: 98,427,619 (GRCm39) V650E possibly damaging Het
Slit2 T C 5: 48,349,568 (GRCm39) V274A possibly damaging Het
Snd1 A G 6: 28,795,936 (GRCm39) E593G probably null Het
Spata2l C T 8: 123,960,873 (GRCm39) V139M probably benign Het
Suco T C 1: 161,684,427 (GRCm39) K231R probably damaging Het
Tenm3 C A 8: 49,008,935 (GRCm39) probably benign Het
Tg T C 15: 66,699,118 (GRCm39) S2415P possibly damaging Het
Traf6 C A 2: 101,527,072 (GRCm39) A274D possibly damaging Het
Usp14 A G 18: 9,996,239 (GRCm39) I447T possibly damaging Het
Usp32 G A 11: 84,942,028 (GRCm39) L355F probably benign Het
Vcpip1 T C 1: 9,817,927 (GRCm39) N152S possibly damaging Het
Vgf A G 5: 137,061,110 (GRCm39) Q424R probably benign Het
Vmn2r84 A T 10: 130,227,993 (GRCm39) M81K possibly damaging Het
Washc5 G A 15: 59,218,067 (GRCm39) A732V possibly damaging Het
Xrcc3 T G 12: 111,771,485 (GRCm39) D213A probably damaging Het
Zeb2 T C 2: 44,886,988 (GRCm39) T690A probably benign Het
Zfat G A 15: 67,956,250 (GRCm39) S1212L probably damaging Het
Zfp623 C T 15: 75,819,949 (GRCm39) L302F probably damaging Het
Zfp799 A C 17: 33,039,733 (GRCm39) C178G possibly damaging Het
Zfy1 T C Y: 727,634 (GRCm39) E348G unknown Het
Zhx3 A G 2: 160,621,393 (GRCm39) W925R possibly damaging Het
Other mutations in Dock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34,595,488 (GRCm39) missense probably damaging 1.00
IGL00469:Dock2 APN 11 34,179,603 (GRCm39) splice site probably benign
IGL01061:Dock2 APN 11 34,596,653 (GRCm39) missense probably damaging 1.00
IGL01319:Dock2 APN 11 34,589,617 (GRCm39) missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34,260,390 (GRCm39) missense probably damaging 1.00
IGL01490:Dock2 APN 11 34,596,608 (GRCm39) missense probably damaging 0.97
IGL01601:Dock2 APN 11 34,189,528 (GRCm39) critical splice donor site probably null
IGL01800:Dock2 APN 11 34,647,100 (GRCm39) missense probably damaging 1.00
IGL01804:Dock2 APN 11 34,212,433 (GRCm39) missense probably benign 0.01
IGL01823:Dock2 APN 11 34,212,391 (GRCm39) missense probably damaging 1.00
IGL01829:Dock2 APN 11 34,596,668 (GRCm39) missense probably damaging 0.98
IGL01830:Dock2 APN 11 34,582,744 (GRCm39) nonsense probably null
IGL01835:Dock2 APN 11 34,260,435 (GRCm39) missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34,599,692 (GRCm39) missense probably benign 0.02
IGL01953:Dock2 APN 11 34,623,183 (GRCm39) missense probably benign 0.28
IGL01989:Dock2 APN 11 34,218,053 (GRCm39) missense probably benign
IGL02081:Dock2 APN 11 34,204,355 (GRCm39) missense probably benign
IGL02105:Dock2 APN 11 34,605,352 (GRCm39) missense probably damaging 1.00
IGL02153:Dock2 APN 11 34,180,670 (GRCm39) missense probably benign 0.01
IGL02170:Dock2 APN 11 34,217,949 (GRCm39) missense probably damaging 1.00
IGL02344:Dock2 APN 11 34,622,337 (GRCm39) missense probably damaging 0.98
IGL02389:Dock2 APN 11 34,589,567 (GRCm39) splice site probably benign
IGL02409:Dock2 APN 11 34,451,204 (GRCm39) missense probably benign 0.00
IGL02472:Dock2 APN 11 34,199,801 (GRCm39) missense probably benign 0.00
IGL02625:Dock2 APN 11 34,451,168 (GRCm39) critical splice donor site probably null
IGL02929:Dock2 APN 11 34,218,048 (GRCm39) missense probably damaging 1.00
IGL02951:Dock2 APN 11 34,260,448 (GRCm39) unclassified probably benign
IGL02999:Dock2 APN 11 34,583,086 (GRCm39) missense probably damaging 0.99
IGL03165:Dock2 APN 11 34,578,360 (GRCm39) missense probably damaging 0.99
Arches UTSW 11 34,580,587 (GRCm39) missense probably damaging 1.00
capitol_reef UTSW 11 34,244,170 (GRCm39) critical splice acceptor site probably null
Croesus UTSW 11 34,611,854 (GRCm39) missense probably damaging 1.00
denali UTSW 11 34,179,472 (GRCm39) critical splice donor site probably null
dew UTSW 11 34,198,636 (GRCm39) nonsense probably null
Dinghy UTSW 11 34,212,460 (GRCm39) missense possibly damaging 0.70
Dry UTSW 11 34,181,652 (GRCm39) missense possibly damaging 0.79
frazz UTSW 11 34,198,572 (GRCm39) critical splice donor site probably benign
frizz UTSW 11 34,208,184 (GRCm39) splice site probably benign
gildenstern UTSW 11 34,623,166 (GRCm39) critical splice donor site probably null
godsgrace UTSW 11 34,586,280 (GRCm39) missense probably damaging 1.00
Harborside UTSW 11 34,212,445 (GRCm39) missense probably benign
Landing UTSW 11 34,605,328 (GRCm39) missense possibly damaging 0.83
latest UTSW 11 34,647,049 (GRCm39) missense probably damaging 1.00
Launch UTSW 11 34,206,562 (GRCm39) missense probably damaging 1.00
liaoning UTSW 11 34,599,620 (GRCm39) missense probably damaging 1.00
lucre UTSW 11 34,595,436 (GRCm39) frame shift probably null
midas UTSW 11 34,244,323 (GRCm39) missense probably damaging 0.99
muelle UTSW 11 34,578,365 (GRCm39) missense probably damaging 1.00
narrowest UTSW 11 34,232,652 (GRCm39) missense probably damaging 0.98
pier UTSW 11 34,580,593 (GRCm39) missense probably damaging 1.00
Plank UTSW 11 34,674,622 (GRCm39) missense possibly damaging 0.51
resplendent UTSW 11 34,618,287 (GRCm39) nonsense probably null
riches UTSW 11 34,579,279 (GRCm39) critical splice donor site probably null
skiff UTSW 11 34,212,388 (GRCm39) missense probably null 0.80
Slip UTSW 11 34,244,286 (GRCm39) missense probably benign 0.25
toothskin UTSW 11 34,414,922 (GRCm39) missense probably damaging 1.00
Touch UTSW 11 34,223,750 (GRCm39) missense possibly damaging 0.95
wassup UTSW 11 34,453,413 (GRCm39) missense probably damaging 1.00
Wharf UTSW 11 34,623,198 (GRCm39) missense possibly damaging 0.81
BB009:Dock2 UTSW 11 34,217,998 (GRCm39) missense probably benign 0.00
BB019:Dock2 UTSW 11 34,217,998 (GRCm39) missense probably benign 0.00
IGL03052:Dock2 UTSW 11 34,182,853 (GRCm39) missense probably benign 0.01
PIT4377001:Dock2 UTSW 11 34,611,835 (GRCm39) missense probably benign 0.02
R0006:Dock2 UTSW 11 34,262,453 (GRCm39) unclassified probably benign
R0012:Dock2 UTSW 11 34,674,622 (GRCm39) missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34,647,111 (GRCm39) critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34,647,111 (GRCm39) critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34,579,392 (GRCm39) intron probably benign
R0149:Dock2 UTSW 11 34,388,327 (GRCm39) missense probably damaging 1.00
R0361:Dock2 UTSW 11 34,388,327 (GRCm39) missense probably damaging 1.00
R0462:Dock2 UTSW 11 34,218,052 (GRCm39) missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34,579,380 (GRCm39) missense probably benign 0.30
R0538:Dock2 UTSW 11 34,595,545 (GRCm39) splice site probably benign
R0543:Dock2 UTSW 11 34,244,325 (GRCm39) missense probably damaging 1.00
R0660:Dock2 UTSW 11 34,198,621 (GRCm39) missense probably damaging 1.00
R0676:Dock2 UTSW 11 34,586,063 (GRCm39) missense probably damaging 0.99
R0722:Dock2 UTSW 11 34,414,970 (GRCm39) splice site probably benign
R0801:Dock2 UTSW 11 34,599,620 (GRCm39) missense probably damaging 1.00
R1110:Dock2 UTSW 11 34,206,535 (GRCm39) missense possibly damaging 0.78
R1171:Dock2 UTSW 11 34,586,068 (GRCm39) missense probably damaging 1.00
R1387:Dock2 UTSW 11 34,223,309 (GRCm39) splice site probably benign
R1445:Dock2 UTSW 11 34,189,705 (GRCm39) missense probably benign
R1494:Dock2 UTSW 11 34,232,761 (GRCm39) nonsense probably null
R1589:Dock2 UTSW 11 34,597,288 (GRCm39) missense probably damaging 0.99
R1597:Dock2 UTSW 11 34,595,474 (GRCm39) missense probably benign 0.00
R1629:Dock2 UTSW 11 34,212,480 (GRCm39) splice site probably null
R1749:Dock2 UTSW 11 34,182,767 (GRCm39) critical splice donor site probably null
R1888:Dock2 UTSW 11 34,598,169 (GRCm39) missense probably damaging 1.00
R1888:Dock2 UTSW 11 34,598,169 (GRCm39) missense probably damaging 1.00
R1899:Dock2 UTSW 11 34,244,286 (GRCm39) missense probably benign 0.25
R1924:Dock2 UTSW 11 34,414,934 (GRCm39) missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34,618,297 (GRCm39) splice site probably benign
R2045:Dock2 UTSW 11 34,244,106 (GRCm39) splice site probably null
R2098:Dock2 UTSW 11 34,609,832 (GRCm39) missense probably damaging 0.99
R2098:Dock2 UTSW 11 34,216,279 (GRCm39) missense probably benign 0.16
R2129:Dock2 UTSW 11 34,618,242 (GRCm39) missense probably damaging 1.00
R2147:Dock2 UTSW 11 34,179,472 (GRCm39) critical splice donor site probably null
R2149:Dock2 UTSW 11 34,179,472 (GRCm39) critical splice donor site probably null
R2150:Dock2 UTSW 11 34,179,472 (GRCm39) critical splice donor site probably null
R2176:Dock2 UTSW 11 34,586,044 (GRCm39) missense probably benign 0.00
R2230:Dock2 UTSW 11 34,244,323 (GRCm39) missense probably damaging 0.99
R2508:Dock2 UTSW 11 34,262,485 (GRCm39) missense probably benign 0.04
R2875:Dock2 UTSW 11 34,609,712 (GRCm39) missense probably damaging 1.00
R2885:Dock2 UTSW 11 34,580,593 (GRCm39) missense probably damaging 1.00
R2910:Dock2 UTSW 11 34,182,910 (GRCm39) splice site probably benign
R3081:Dock2 UTSW 11 34,181,610 (GRCm39) missense probably benign
R3418:Dock2 UTSW 11 34,580,587 (GRCm39) missense probably damaging 1.00
R3552:Dock2 UTSW 11 34,611,787 (GRCm39) missense probably benign 0.22
R3731:Dock2 UTSW 11 34,599,722 (GRCm39) missense probably damaging 1.00
R3846:Dock2 UTSW 11 34,623,198 (GRCm39) missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34,605,328 (GRCm39) missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34,189,536 (GRCm39) missense probably damaging 1.00
R4599:Dock2 UTSW 11 34,189,536 (GRCm39) missense probably damaging 1.00
R4715:Dock2 UTSW 11 34,244,118 (GRCm39) missense probably damaging 1.00
R4722:Dock2 UTSW 11 34,586,298 (GRCm39) missense probably damaging 1.00
R4742:Dock2 UTSW 11 34,244,170 (GRCm39) critical splice acceptor site probably null
R4830:Dock2 UTSW 11 34,223,767 (GRCm39) splice site probably null
R4884:Dock2 UTSW 11 34,216,248 (GRCm39) missense probably damaging 1.00
R4990:Dock2 UTSW 11 34,586,078 (GRCm39) missense probably damaging 1.00
R5334:Dock2 UTSW 11 34,178,643 (GRCm39) missense probably benign 0.00
R5570:Dock2 UTSW 11 34,618,233 (GRCm39) missense probably damaging 1.00
R5602:Dock2 UTSW 11 34,204,391 (GRCm39) missense probably benign 0.16
R5681:Dock2 UTSW 11 34,199,836 (GRCm39) missense probably benign 0.06
R5809:Dock2 UTSW 11 34,212,445 (GRCm39) missense probably benign
R5860:Dock2 UTSW 11 34,206,562 (GRCm39) missense probably damaging 1.00
R6111:Dock2 UTSW 11 34,599,614 (GRCm39) missense probably damaging 0.99
R6155:Dock2 UTSW 11 34,244,123 (GRCm39) missense probably benign 0.06
R6156:Dock2 UTSW 11 34,197,789 (GRCm39) missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34,212,388 (GRCm39) missense probably null 0.80
R6182:Dock2 UTSW 11 34,179,476 (GRCm39) missense probably damaging 0.97
R6188:Dock2 UTSW 11 34,453,396 (GRCm39) missense probably damaging 0.98
R6191:Dock2 UTSW 11 34,181,652 (GRCm39) missense possibly damaging 0.79
R6283:Dock2 UTSW 11 34,598,152 (GRCm39) missense probably damaging 0.99
R6395:Dock2 UTSW 11 34,182,874 (GRCm39) missense probably damaging 1.00
R6465:Dock2 UTSW 11 34,453,413 (GRCm39) missense probably damaging 1.00
R6500:Dock2 UTSW 11 34,312,822 (GRCm39) missense possibly damaging 0.76
R6561:Dock2 UTSW 11 34,578,365 (GRCm39) missense probably damaging 1.00
R6745:Dock2 UTSW 11 34,596,670 (GRCm39) missense probably damaging 1.00
R6745:Dock2 UTSW 11 34,596,669 (GRCm39) missense probably damaging 1.00
R6880:Dock2 UTSW 11 34,579,279 (GRCm39) critical splice donor site probably null
R6913:Dock2 UTSW 11 34,647,049 (GRCm39) missense probably damaging 1.00
R6997:Dock2 UTSW 11 34,414,922 (GRCm39) missense probably damaging 1.00
R7057:Dock2 UTSW 11 34,586,044 (GRCm39) missense probably benign 0.00
R7057:Dock2 UTSW 11 34,177,684 (GRCm39) missense probably benign 0.10
R7134:Dock2 UTSW 11 34,260,363 (GRCm39) missense probably benign 0.03
R7188:Dock2 UTSW 11 34,189,675 (GRCm39) missense possibly damaging 0.87
R7239:Dock2 UTSW 11 34,181,677 (GRCm39) missense probably benign 0.00
R7247:Dock2 UTSW 11 34,605,340 (GRCm39) nonsense probably null
R7250:Dock2 UTSW 11 34,586,120 (GRCm39) missense probably damaging 1.00
R7250:Dock2 UTSW 11 34,586,032 (GRCm39) missense probably benign 0.01
R7271:Dock2 UTSW 11 34,223,750 (GRCm39) missense possibly damaging 0.95
R7284:Dock2 UTSW 11 34,180,672 (GRCm39) missense probably benign 0.01
R7397:Dock2 UTSW 11 34,609,816 (GRCm39) missense probably benign 0.00
R7464:Dock2 UTSW 11 34,586,105 (GRCm39) missense probably damaging 0.99
R7512:Dock2 UTSW 11 34,262,542 (GRCm39) missense possibly damaging 0.95
R7556:Dock2 UTSW 11 34,611,778 (GRCm39) missense probably benign 0.43
R7663:Dock2 UTSW 11 34,611,854 (GRCm39) missense probably damaging 1.00
R7779:Dock2 UTSW 11 34,605,282 (GRCm39) missense probably benign 0.38
R7797:Dock2 UTSW 11 34,232,652 (GRCm39) missense probably damaging 0.98
R7855:Dock2 UTSW 11 34,223,698 (GRCm39) missense probably damaging 1.00
R7922:Dock2 UTSW 11 34,598,154 (GRCm39) missense probably benign 0.29
R7932:Dock2 UTSW 11 34,217,998 (GRCm39) missense probably benign 0.00
R8013:Dock2 UTSW 11 34,596,677 (GRCm39) missense probably damaging 0.96
R8192:Dock2 UTSW 11 34,623,166 (GRCm39) critical splice donor site probably null
R8244:Dock2 UTSW 11 34,586,280 (GRCm39) missense probably damaging 1.00
R8307:Dock2 UTSW 11 34,260,362 (GRCm39) missense possibly damaging 0.95
R8418:Dock2 UTSW 11 34,609,795 (GRCm39) missense probably benign 0.01
R8460:Dock2 UTSW 11 34,180,825 (GRCm39) critical splice acceptor site probably null
R8495:Dock2 UTSW 11 34,181,622 (GRCm39) missense probably benign 0.14
R8556:Dock2 UTSW 11 34,212,457 (GRCm39) missense possibly damaging 0.84
R8690:Dock2 UTSW 11 34,618,287 (GRCm39) nonsense probably null
R8743:Dock2 UTSW 11 34,223,252 (GRCm39) nonsense probably null
R8757:Dock2 UTSW 11 34,586,067 (GRCm39) missense probably benign 0.13
R8759:Dock2 UTSW 11 34,586,067 (GRCm39) missense probably benign 0.13
R8793:Dock2 UTSW 11 34,451,215 (GRCm39) missense probably benign 0.00
R8882:Dock2 UTSW 11 34,595,436 (GRCm39) frame shift probably null
R8885:Dock2 UTSW 11 34,260,396 (GRCm39) missense probably benign 0.01
R8943:Dock2 UTSW 11 34,599,646 (GRCm39) missense possibly damaging 0.63
R9171:Dock2 UTSW 11 34,589,670 (GRCm39) missense probably benign 0.12
R9182:Dock2 UTSW 11 34,260,398 (GRCm39) missense possibly damaging 0.51
R9203:Dock2 UTSW 11 34,622,366 (GRCm39) missense possibly damaging 0.92
R9388:Dock2 UTSW 11 34,212,460 (GRCm39) missense possibly damaging 0.70
R9490:Dock2 UTSW 11 34,589,582 (GRCm39) missense possibly damaging 0.90
R9568:Dock2 UTSW 11 34,599,638 (GRCm39) missense possibly damaging 0.83
R9593:Dock2 UTSW 11 34,178,607 (GRCm39) missense probably benign 0.34
R9694:Dock2 UTSW 11 34,218,054 (GRCm39) missense probably benign
R9697:Dock2 UTSW 11 34,204,417 (GRCm39) missense probably benign
R9753:Dock2 UTSW 11 34,223,673 (GRCm39) missense possibly damaging 0.68
R9783:Dock2 UTSW 11 34,208,128 (GRCm39) missense possibly damaging 0.83
X0017:Dock2 UTSW 11 34,216,271 (GRCm39) missense probably benign 0.08
X0018:Dock2 UTSW 11 34,182,833 (GRCm39) missense possibly damaging 0.65
X0058:Dock2 UTSW 11 34,206,564 (GRCm39) missense probably damaging 1.00
X0066:Dock2 UTSW 11 34,260,357 (GRCm39) missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34,583,209 (GRCm39) missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34,388,300 (GRCm39) missense probably benign 0.14
Z1088:Dock2 UTSW 11 34,586,039 (GRCm39) nonsense probably null
Z1176:Dock2 UTSW 11 34,609,751 (GRCm39) missense probably benign 0.04
Z1177:Dock2 UTSW 11 34,262,553 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGGGATGCATGACAACAGTTC -3'
(R):5'- TCACTCAGGACTCTCTGCAG -3'

Sequencing Primer
(F):5'- GGATGCATGACAACAGTTCTCACAC -3'
(R):5'- AGCTGGAGCAGTTCACAC -3'
Posted On 2022-03-25