Incidental Mutation 'R9310:Myh4'
ID 705487
Institutional Source Beutler Lab
Gene Symbol Myh4
Ensembl Gene ENSMUSG00000057003
Gene Name myosin, heavy polypeptide 4, skeletal muscle
Synonyms MM, Minimsc, MYH-2B, MyHC-IIb, Minmus, MHC2B, Myhsf
Accession Numbers

Genbank: NM_010855; MGI: 1339713

Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67238029-67260446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67254744 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1351 (Y1351C)
Ref Sequence ENSEMBL: ENSMUSP00000127514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018632] [ENSMUST00000170942]
AlphaFold Q5SX39
Predicted Effect probably damaging
Transcript: ENSMUST00000018632
AA Change: Y1351C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018632
Gene: ENSMUSG00000057003
AA Change: Y1351C

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 4.7e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
Pfam:Myosin_tail_1 847 1928 2.5e-168 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170942
AA Change: Y1351C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127514
Gene: ENSMUSG00000057003
AA Change: Y1351C

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-15 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
low complexity region 928 942 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit decreased growth and muscle defects including reduced muscle mass, muscle fiber loss, compensatory fiber hypertrophy, and impaired strength. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 116,972,120 I83V possibly damaging Het
Abcf1 G A 17: 35,961,729 A288V probably null Het
Acer1 A T 17: 56,955,598 V184D probably damaging Het
Apoh T C 11: 108,407,481 probably null Het
Arid1a T C 4: 133,686,314 Y959C unknown Het
Asb3 A T 11: 31,028,962 H84L probably benign Het
Atxn1 A C 13: 45,568,018 Y134D probably damaging Het
BC055324 A G 1: 163,964,520 C610R probably damaging Het
Btbd1 T C 7: 81,829,237 Y52C probably damaging Het
Cabp2 A G 19: 4,086,464 D170G probably damaging Het
Cacna1a C A 8: 84,536,417 A407E probably damaging Het
Cacna2d4 T A 6: 119,271,953 probably null Het
Cc2d2a T C 5: 43,695,146 F404S probably damaging Het
Cdh20 T C 1: 104,947,336 M281T probably damaging Het
Cfap54 A T 10: 92,962,315 M1694K unknown Het
Chd6 G T 2: 161,039,261 T261K probably damaging Het
Cnksr1 T C 4: 134,229,019 S585G probably damaging Het
Cntnap2 A T 6: 46,001,347 Y312F probably damaging Het
Coa7 T A 4: 108,338,313 Y146* probably null Het
Col28a1 T C 6: 8,175,414 K145E unknown Het
Coq8b T A 7: 27,242,061 I221N probably damaging Het
Cpd A T 11: 76,814,781 L375* probably null Het
Dnah5 T C 15: 28,448,433 F4214S probably damaging Het
Dock2 A G 11: 34,294,139 F1067S possibly damaging Het
Dpp6 G A 5: 27,631,441 A310T probably damaging Het
Dpp6 C A 5: 27,725,644 L825I probably benign Het
Efcab5 A G 11: 77,113,705 V929A probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Espl1 G A 15: 102,296,850 probably null Het
Gm4847 T C 1: 166,632,712 R402G probably benign Het
Grid1 T C 14: 35,026,805 L194S probably damaging Het
Heatr1 A T 13: 12,438,610 H2122L probably benign Het
Il17b T A 18: 61,692,263 C123* probably null Het
Il17rc T C 6: 113,474,249 L181P probably damaging Het
Inpp5e T A 2: 26,397,928 I619L probably benign Het
Itgax C A 7: 128,142,260 Y814* probably null Het
Marcks C T 10: 37,136,491 E183K unknown Het
Mefv T C 16: 3,715,388 T340A probably benign Het
Mical2 A G 7: 112,351,713 K958R probably benign Het
Mkl2 T A 16: 13,401,090 D533E probably benign Het
Mtor T A 4: 148,469,377 L811Q probably benign Het
Neb T C 2: 52,263,696 M2406V probably benign Het
Nebl T C 2: 17,348,867 T214A probably benign Het
Nlrx1 A T 9: 44,253,408 I913N probably damaging Het
Npr2 G T 4: 43,632,404 A74S probably benign Het
Olfr1220 T A 2: 89,097,913 S5C probably damaging Het
Olfr711 C A 7: 106,971,471 C291F probably damaging Het
Olfr794 T A 10: 129,570,818 N54K probably benign Het
Pard3b G T 1: 62,166,369 V441F probably damaging Het
Pcsk1 G A 13: 75,090,072 R4K probably benign Het
Pisd G T 5: 32,737,440 N337K possibly damaging Het
Pml T C 9: 58,249,662 K10R probably benign Het
Prkci T C 3: 31,029,515 W132R probably damaging Het
Prrc2a A T 17: 35,155,999 M1225K probably benign Het
Prss23 T C 7: 89,509,934 D309G probably damaging Het
Pxdn G A 12: 30,002,052 G743S probably damaging Het
Rab29 A T 1: 131,872,122 E145V probably damaging Het
Rasef C T 4: 73,735,719 probably null Het
Rcbtb1 T G 14: 59,235,250 I496S probably benign Het
Rcor1 T C 12: 111,099,959 Y228H Het
Reep5 C T 18: 34,357,169 V92I probably damaging Het
Rfx3 T C 19: 27,849,929 S86G probably benign Het
Rptn T A 3: 93,397,077 D572E probably benign Het
Rsl1 A T 13: 67,176,446 probably null Het
Sbf2 T C 7: 110,315,085 E1630G possibly damaging Het
Sele G A 1: 164,049,406 V84I probably benign Het
Serpina1b T C 12: 103,732,497 D31G probably benign Het
Serpina3c T C 12: 104,149,554 I244V probably benign Het
Serpinb6e A G 13: 33,833,221 V272A probably benign Het
Serpinb9b A G 13: 33,035,540 D150G probably benign Het
Sgpp1 T C 12: 75,722,600 T265A probably benign Het
Slc9a1 T A 4: 133,416,370 M389K probably damaging Het
Slco3a1 A T 7: 74,554,488 C35S probably damaging Het
Slco6d1 T A 1: 98,499,894 V650E possibly damaging Het
Slit2 T C 5: 48,192,226 V274A possibly damaging Het
Snd1 A G 6: 28,795,937 E593G probably null Het
Spata2l C T 8: 123,234,134 V139M probably benign Het
Suco T C 1: 161,856,858 K231R probably damaging Het
Tenm3 C A 8: 48,555,900 probably benign Het
Tg T C 15: 66,827,269 S2415P possibly damaging Het
Traf6 C A 2: 101,696,727 A274D possibly damaging Het
Usp14 A G 18: 9,996,239 I447T possibly damaging Het
Usp32 G A 11: 85,051,202 L355F probably benign Het
Vcpip1 T C 1: 9,747,702 N152S possibly damaging Het
Vgf A G 5: 137,032,256 Q424R probably benign Het
Vmn2r84 A T 10: 130,392,124 M81K possibly damaging Het
Washc5 G A 15: 59,346,218 A732V possibly damaging Het
Wdr63 C T 3: 146,097,140 probably null Het
Xrcc3 T G 12: 111,805,051 D213A probably damaging Het
Zeb2 T C 2: 44,996,976 T690A probably benign Het
Zfat G A 15: 68,084,401 S1212L probably damaging Het
Zfp623 C T 15: 75,948,100 L302F probably damaging Het
Zfp799 A C 17: 32,820,759 C178G possibly damaging Het
Zfy1 T C Y: 727,634 E348G unknown Het
Zhx3 A G 2: 160,779,473 W925R possibly damaging Het
Other mutations in Myh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Myh4 APN 11 67255379 missense probably damaging 1.00
IGL01600:Myh4 APN 11 67260189 missense possibly damaging 0.85
IGL01737:Myh4 APN 11 67243419 splice site probably benign
IGL02208:Myh4 APN 11 67251934 missense possibly damaging 0.96
IGL02334:Myh4 APN 11 67245547 missense probably damaging 1.00
IGL02376:Myh4 APN 11 67245728 missense probably benign 0.00
IGL02429:Myh4 APN 11 67258982 nonsense probably null
IGL02450:Myh4 APN 11 67251809 missense probably damaging 1.00
IGL02524:Myh4 APN 11 67249240 missense possibly damaging 0.79
IGL02612:Myh4 APN 11 67256479 missense probably benign
IGL03024:Myh4 APN 11 67248479 missense probably damaging 1.00
IGL03065:Myh4 APN 11 67259156 missense probably benign 0.12
IGL03084:Myh4 APN 11 67251951 splice site probably null
IGL03188:Myh4 APN 11 67246543 critical splice donor site probably null
IGL03204:Myh4 APN 11 67250296 missense possibly damaging 0.63
IGL03252:Myh4 APN 11 67252216 missense probably damaging 0.99
IGL03345:Myh4 APN 11 67255478 missense probably damaging 1.00
Mr_chicken UTSW 11 67249885 missense possibly damaging 0.74
Mrs_muir UTSW 11 67245513 missense probably damaging 1.00
Willies UTSW 11 67241509 missense probably damaging 1.00
F6893:Myh4 UTSW 11 67255457 missense probably null 0.12
PIT1430001:Myh4 UTSW 11 67258832 missense probably benign 0.01
PIT4458001:Myh4 UTSW 11 67240995 missense possibly damaging 0.56
R0099:Myh4 UTSW 11 67259347 missense probably benign
R0194:Myh4 UTSW 11 67252336 missense probably damaging 1.00
R0346:Myh4 UTSW 11 67260326 missense probably benign
R0427:Myh4 UTSW 11 67258653 missense probably damaging 0.98
R0483:Myh4 UTSW 11 67252297 missense probably damaging 1.00
R0571:Myh4 UTSW 11 67250331 missense possibly damaging 0.91
R0854:Myh4 UTSW 11 67259147 missense possibly damaging 0.90
R0940:Myh4 UTSW 11 67242863 missense probably damaging 1.00
R0946:Myh4 UTSW 11 67251751 missense possibly damaging 0.70
R1108:Myh4 UTSW 11 67255706 missense probably null 0.01
R1162:Myh4 UTSW 11 67258613 missense probably damaging 0.97
R1194:Myh4 UTSW 11 67255734 critical splice donor site probably null
R1347:Myh4 UTSW 11 67244741 splice site probably benign
R1457:Myh4 UTSW 11 67248461 missense probably damaging 0.99
R1531:Myh4 UTSW 11 67250540 missense probably benign 0.01
R1716:Myh4 UTSW 11 67250309 missense possibly damaging 0.92
R1766:Myh4 UTSW 11 67256295 missense possibly damaging 0.61
R1796:Myh4 UTSW 11 67260324 missense probably benign
R1856:Myh4 UTSW 11 67255682 missense probably damaging 1.00
R1873:Myh4 UTSW 11 67254743 missense probably benign 0.16
R2069:Myh4 UTSW 11 67246366 splice site probably benign
R2370:Myh4 UTSW 11 67255628 missense probably damaging 1.00
R2406:Myh4 UTSW 11 67259174 missense probably damaging 1.00
R2414:Myh4 UTSW 11 67250768 missense probably benign 0.01
R2848:Myh4 UTSW 11 67248633 missense probably benign 0.20
R3111:Myh4 UTSW 11 67246450 missense possibly damaging 0.86
R3744:Myh4 UTSW 11 67255315 missense probably damaging 1.00
R3845:Myh4 UTSW 11 67259105 missense possibly damaging 0.90
R3877:Myh4 UTSW 11 67257183 missense probably benign 0.00
R4498:Myh4 UTSW 11 67251752 missense probably damaging 1.00
R4514:Myh4 UTSW 11 67255569 missense probably benign 0.06
R4601:Myh4 UTSW 11 67250310 missense possibly damaging 0.94
R4673:Myh4 UTSW 11 67246401 missense probably benign 0.02
R4684:Myh4 UTSW 11 67245811 missense probably damaging 0.99
R4736:Myh4 UTSW 11 67240920 missense probably benign 0.01
R4837:Myh4 UTSW 11 67258992 missense probably benign 0.38
R4866:Myh4 UTSW 11 67248627 missense probably benign 0.00
R4869:Myh4 UTSW 11 67252664 missense probably damaging 1.00
R4887:Myh4 UTSW 11 67241054 missense probably damaging 0.99
R4921:Myh4 UTSW 11 67254028 missense probably damaging 1.00
R5005:Myh4 UTSW 11 67253415 missense probably benign 0.05
R5008:Myh4 UTSW 11 67253532 missense probably benign 0.00
R5011:Myh4 UTSW 11 67256363 missense probably benign 0.03
R5087:Myh4 UTSW 11 67255409 missense probably damaging 1.00
R5277:Myh4 UTSW 11 67252354 missense probably damaging 1.00
R5336:Myh4 UTSW 11 67259191 splice site probably null
R5354:Myh4 UTSW 11 67255725 missense possibly damaging 0.69
R5371:Myh4 UTSW 11 67259324 missense probably damaging 1.00
R5484:Myh4 UTSW 11 67251818 missense probably damaging 1.00
R5774:Myh4 UTSW 11 67253208 nonsense probably null
R5902:Myh4 UTSW 11 67250907 missense possibly damaging 0.69
R5941:Myh4 UTSW 11 67259300 missense probably damaging 0.99
R6045:Myh4 UTSW 11 67244724 missense probably benign 0.32
R6156:Myh4 UTSW 11 67250792 missense probably benign 0.00
R6301:Myh4 UTSW 11 67255333 missense possibly damaging 0.95
R6318:Myh4 UTSW 11 67243442 missense probably benign 0.02
R6352:Myh4 UTSW 11 67252282 missense probably damaging 1.00
R6385:Myh4 UTSW 11 67255837 missense probably damaging 1.00
R6493:Myh4 UTSW 11 67258629 missense probably benign 0.16
R6666:Myh4 UTSW 11 67251812 missense probably damaging 1.00
R6826:Myh4 UTSW 11 67246531 missense probably damaging 1.00
R6852:Myh4 UTSW 11 67252968 splice site probably null
R6857:Myh4 UTSW 11 67249885 missense possibly damaging 0.74
R7029:Myh4 UTSW 11 67246425 missense probably benign 0.40
R7076:Myh4 UTSW 11 67253173 missense possibly damaging 0.85
R7145:Myh4 UTSW 11 67260228 missense possibly damaging 0.54
R7179:Myh4 UTSW 11 67244724 missense probably benign 0.32
R7365:Myh4 UTSW 11 67242848 missense probably damaging 1.00
R7514:Myh4 UTSW 11 67243322 critical splice donor site probably null
R7553:Myh4 UTSW 11 67256395 missense probably damaging 0.99
R7666:Myh4 UTSW 11 67256281 missense probably damaging 0.99
R7673:Myh4 UTSW 11 67245513 missense probably damaging 1.00
R7685:Myh4 UTSW 11 67240930 missense probably benign 0.13
R8154:Myh4 UTSW 11 67253374 missense probably damaging 1.00
R8343:Myh4 UTSW 11 67252564 missense possibly damaging 0.45
R8446:Myh4 UTSW 11 67253521 missense probably benign 0.14
R8534:Myh4 UTSW 11 67243509 missense probably benign 0.17
R8710:Myh4 UTSW 11 67252332 missense probably benign
R8775:Myh4 UTSW 11 67257180 missense probably benign 0.25
R8775-TAIL:Myh4 UTSW 11 67257180 missense probably benign 0.25
R8852:Myh4 UTSW 11 67241509 missense probably damaging 1.00
R8860:Myh4 UTSW 11 67241509 missense probably damaging 1.00
R8897:Myh4 UTSW 11 67246536 missense possibly damaging 0.90
R8954:Myh4 UTSW 11 67252980 missense possibly damaging 0.95
R8957:Myh4 UTSW 11 67250954 missense possibly damaging 0.78
R9065:Myh4 UTSW 11 67248747 missense probably benign
R9280:Myh4 UTSW 11 67255309 missense probably damaging 0.96
R9296:Myh4 UTSW 11 67255304 missense possibly damaging 0.95
R9314:Myh4 UTSW 11 67260315 missense probably benign 0.01
R9462:Myh4 UTSW 11 67250985 missense possibly damaging 0.93
R9516:Myh4 UTSW 11 67248464 missense probably damaging 0.99
R9516:Myh4 UTSW 11 67250303 missense probably damaging 1.00
X0027:Myh4 UTSW 11 67246480 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67248641 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67253505 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67256271 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGTGAGAACCCTCTGTTGAG -3'
(R):5'- TGAGTACATGGTCCTCTTAACTG -3'

Sequencing Primer
(F):5'- GAGAACCCTCTGTTGAGACTTTCATG -3'
(R):5'- GGAAGCTGTGAAATTATTTGATGCTC -3'
Posted On 2022-03-25