Incidental Mutation 'R0737:Ppp2r2b'
ID70549
Institutional Source Beutler Lab
Gene Symbol Ppp2r2b
Ensembl Gene ENSMUSG00000024500
Gene Nameprotein phosphatase 2, regulatory subunit B, beta
SynonymsSCA12, 6330404L05Rik, 2900026H06Rik, E130009M08Rik, PR55-BETA, PP2A-PR55B
MMRRC Submission 038918-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0737 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location42637432-43059471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43059192 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 17 (T17A)
Ref Sequence ENSEMBL: ENSMUSP00000025377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025377]
Predicted Effect probably benign
Transcript: ENSMUST00000025377
AA Change: T17A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025377
Gene: ENSMUSG00000024500
AA Change: T17A

DomainStartEndE-ValueType
WD40 14 55 6.42e-1 SMART
WD40 82 122 3.7e0 SMART
WD40 164 203 1.66e0 SMART
WD40 214 254 1.38e1 SMART
WD40 273 311 5.7e1 SMART
Blast:WD40 315 369 6e-26 BLAST
WD40 405 442 1.33e1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 70,394,207 probably benign Het
4932429P05Rik A G X: 89,754,320 H586R probably benign Het
9130409I23Rik G A 1: 181,055,379 M235I probably benign Het
Aff4 T A 11: 53,410,953 L1043* probably null Het
Ankrd11 G T 8: 122,895,836 R426S probably damaging Het
Atm T A 9: 53,456,566 N2422I probably damaging Het
Bahcc1 C A 11: 120,272,841 P655Q probably damaging Het
Baz2a A G 10: 128,116,080 I556V possibly damaging Het
BC017643 C T 11: 121,227,242 probably null Het
Ccdc33 T C 9: 58,082,048 D114G probably damaging Het
Cdk5rap2 T C 4: 70,337,375 H424R probably benign Het
Cfap57 T C 4: 118,581,102 E864G possibly damaging Het
Cit T A 5: 115,946,919 S836R probably damaging Het
Clip4 C T 17: 71,837,699 Q95* probably null Het
Col17a1 C T 19: 47,669,433 G433S possibly damaging Het
Col6a3 A G 1: 90,828,298 F90L probably damaging Het
Dnah9 T C 11: 66,107,898 H1108R probably damaging Het
Elac1 A T 18: 73,739,039 M295K probably damaging Het
Epas1 G T 17: 86,829,456 G816C possibly damaging Het
Ermap C A 4: 119,178,510 C427F probably damaging Het
Fbxo44 T C 4: 148,158,809 probably benign Het
Fmo4 T A 1: 162,808,392 K14* probably null Het
Gadl1 G A 9: 116,073,987 M461I probably damaging Het
Garnl3 T A 2: 32,990,642 I868F probably damaging Het
Gm6614 G T 6: 142,003,428 A74E possibly damaging Het
Gm7168 A G 17: 13,948,983 D204G probably damaging Het
Hs6st3 T C 14: 119,869,383 F401S possibly damaging Het
Kcnmb1 A T 11: 33,964,701 M1L probably benign Het
Krt35 T C 11: 100,093,794 T292A probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lamb2 T A 9: 108,483,794 W572R probably benign Het
Letmd1 A G 15: 100,469,821 T87A probably damaging Het
Lrp2 A G 2: 69,448,169 Y3947H probably damaging Het
Mocos T C 18: 24,688,987 F685L probably damaging Het
Nsun6 A T 2: 14,996,474 F424I probably damaging Het
Nup88 A G 11: 70,969,950 M1T probably null Het
Olfr1209 T C 2: 88,910,273 N40S probably damaging Het
Olfr1339 C T 4: 118,735,224 R232C probably benign Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Pcdhb12 T A 18: 37,437,709 V636D probably damaging Het
Pclo C A 5: 14,515,439 A73E probably damaging Het
Pdlim7 A T 13: 55,504,880 probably null Het
Phldb1 G A 9: 44,699,636 P67S possibly damaging Het
Rab11fip4 T C 11: 79,683,502 V241A probably benign Het
Slc41a1 T C 1: 131,840,952 L216P probably damaging Het
Smg6 T A 11: 75,159,836 D1352E probably damaging Het
Tbc1d9 A T 8: 83,259,313 I816F probably damaging Het
Tex264 T C 9: 106,659,299 T220A probably benign Het
Tmco6 G A 18: 36,741,776 V439I probably damaging Het
Tmem64 A G 4: 15,266,717 I256V probably damaging Het
Tnks1bp1 A G 2: 85,052,536 S236G possibly damaging Het
Tsc1 A G 2: 28,670,930 T267A possibly damaging Het
Txndc2 A G 17: 65,639,553 probably null Het
Vmn2r94 G A 17: 18,277,433 Q26* probably null Het
Zan T C 5: 137,389,249 D4900G unknown Het
Zkscan3 T C 13: 21,388,596 T122A probably benign Het
Other mutations in Ppp2r2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ppp2r2b APN 18 42645775 missense probably damaging 0.99
IGL01999:Ppp2r2b APN 18 42645723 utr 3 prime probably benign
IGL02610:Ppp2r2b APN 18 42648775 splice site probably benign
IGL02733:Ppp2r2b APN 18 42648728 missense possibly damaging 0.96
IGL02899:Ppp2r2b APN 18 42645809 missense probably damaging 1.00
Degradation UTSW 18 42688338 missense probably benign 0.27
R1459:Ppp2r2b UTSW 18 42737990 missense probably damaging 1.00
R1616:Ppp2r2b UTSW 18 42688310 missense probably benign 0.32
R1635:Ppp2r2b UTSW 18 43059210 missense probably benign 0.01
R3435:Ppp2r2b UTSW 18 42741109 missense possibly damaging 0.48
R4204:Ppp2r2b UTSW 18 42738050 missense probably benign
R4301:Ppp2r2b UTSW 18 42898746 missense probably null
R5062:Ppp2r2b UTSW 18 42688461 missense possibly damaging 0.48
R5147:Ppp2r2b UTSW 18 42645877 missense probably benign 0.00
R5207:Ppp2r2b UTSW 18 42688352 missense probably damaging 1.00
R5277:Ppp2r2b UTSW 18 42741142 missense probably damaging 1.00
R6004:Ppp2r2b UTSW 18 43059159 splice site probably null
R6528:Ppp2r2b UTSW 18 42688338 missense probably benign 0.27
R6735:Ppp2r2b UTSW 18 42688588 splice site probably null
R7521:Ppp2r2b UTSW 18 43059177 missense probably benign
R7831:Ppp2r2b UTSW 18 42701532 missense probably benign
R8405:Ppp2r2b UTSW 18 42645740 missense probably benign 0.00
R8486:Ppp2r2b UTSW 18 42898804 missense probably benign 0.17
Z1177:Ppp2r2b UTSW 18 42648693 missense probably benign 0.04
Z1177:Ppp2r2b UTSW 18 42688423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCCCCAGGAACGACAGTCATC -3'
(R):5'- AGCCAATGAAGAGGCTCTATCCCAG -3'

Sequencing Primer
(F):5'- CGACAGTCATCTAGTAAGCTGC -3'
(R):5'- AATGGGACCCATCTCCAGTG -3'
Posted On2013-09-30