Incidental Mutation 'R9310:Usp32'
ID 705490
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 2900074J03Rik, 6430526O11Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84875268-85030987 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 84942028 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 355 (L355F)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000108075
AA Change: L355F

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: L355F

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 117,698,859 (GRCm39) I83V possibly damaging Het
Abcf1 G A 17: 36,272,621 (GRCm39) A288V probably null Het
Acer1 A T 17: 57,262,598 (GRCm39) V184D probably damaging Het
Apoh T C 11: 108,298,307 (GRCm39) probably null Het
Arid1a T C 4: 133,413,625 (GRCm39) Y959C unknown Het
Asb3 A T 11: 30,978,962 (GRCm39) H84L probably benign Het
Atxn1 A C 13: 45,721,494 (GRCm39) Y134D probably damaging Het
Btbd1 T C 7: 81,478,985 (GRCm39) Y52C probably damaging Het
Cabp2 A G 19: 4,136,464 (GRCm39) D170G probably damaging Het
Cacna1a C A 8: 85,263,046 (GRCm39) A407E probably damaging Het
Cacna2d4 T A 6: 119,248,914 (GRCm39) probably null Het
Cc2d2a T C 5: 43,852,488 (GRCm39) F404S probably damaging Het
Cdh20 T C 1: 104,875,061 (GRCm39) M281T probably damaging Het
Cfap54 A T 10: 92,798,177 (GRCm39) M1694K unknown Het
Chd6 G T 2: 160,881,181 (GRCm39) T261K probably damaging Het
Cnksr1 T C 4: 133,956,330 (GRCm39) S585G probably damaging Het
Cntnap2 A T 6: 45,978,281 (GRCm39) Y312F probably damaging Het
Coa7 T A 4: 108,195,510 (GRCm39) Y146* probably null Het
Col28a1 T C 6: 8,175,414 (GRCm39) K145E unknown Het
Coq8b T A 7: 26,941,486 (GRCm39) I221N probably damaging Het
Cpd A T 11: 76,705,607 (GRCm39) L375* probably null Het
Dnah5 T C 15: 28,448,579 (GRCm39) F4214S probably damaging Het
Dnai3 C T 3: 145,802,895 (GRCm39) probably null Het
Dock2 A G 11: 34,244,139 (GRCm39) F1067S possibly damaging Het
Dpp6 G A 5: 27,836,439 (GRCm39) A310T probably damaging Het
Dpp6 C A 5: 27,930,642 (GRCm39) L825I probably benign Het
Efcab5 A G 11: 77,004,531 (GRCm39) V929A probably benign Het
Ephx3 C G 17: 32,408,290 (GRCm39) D45H probably benign Het
Espl1 G A 15: 102,205,285 (GRCm39) probably null Het
Firrm A G 1: 163,792,089 (GRCm39) C610R probably damaging Het
Gm4847 T C 1: 166,460,281 (GRCm39) R402G probably benign Het
Grid1 T C 14: 34,748,762 (GRCm39) L194S probably damaging Het
Heatr1 A T 13: 12,453,491 (GRCm39) H2122L probably benign Het
Il17b T A 18: 61,825,334 (GRCm39) C123* probably null Het
Il17rc T C 6: 113,451,210 (GRCm39) L181P probably damaging Het
Inpp5e T A 2: 26,287,940 (GRCm39) I619L probably benign Het
Itgax C A 7: 127,741,432 (GRCm39) Y814* probably null Het
Marcks C T 10: 37,012,487 (GRCm39) E183K unknown Het
Mefv T C 16: 3,533,252 (GRCm39) T340A probably benign Het
Mical2 A G 7: 111,950,920 (GRCm39) K958R probably benign Het
Mrtfb T A 16: 13,218,954 (GRCm39) D533E probably benign Het
Mtor T A 4: 148,553,834 (GRCm39) L811Q probably benign Het
Myh4 A G 11: 67,145,570 (GRCm39) Y1351C probably damaging Het
Neb T C 2: 52,153,708 (GRCm39) M2406V probably benign Het
Nebl T C 2: 17,353,678 (GRCm39) T214A probably benign Het
Nlrx1 A T 9: 44,164,705 (GRCm39) I913N probably damaging Het
Npr2 G T 4: 43,632,404 (GRCm39) A74S probably benign Het
Or4c115 T A 2: 88,928,257 (GRCm39) S5C probably damaging Het
Or6b6 C A 7: 106,570,678 (GRCm39) C291F probably damaging Het
Or6c88 T A 10: 129,406,687 (GRCm39) N54K probably benign Het
Pard3b G T 1: 62,205,528 (GRCm39) V441F probably damaging Het
Pcsk1 G A 13: 75,238,191 (GRCm39) R4K probably benign Het
Pisd G T 5: 32,894,784 (GRCm39) N337K possibly damaging Het
Pml T C 9: 58,156,945 (GRCm39) K10R probably benign Het
Prkci T C 3: 31,083,664 (GRCm39) W132R probably damaging Het
Prrc2a A T 17: 35,374,975 (GRCm39) M1225K probably benign Het
Prss23 T C 7: 89,159,142 (GRCm39) D309G probably damaging Het
Pxdn G A 12: 30,052,051 (GRCm39) G743S probably damaging Het
Rab29 A T 1: 131,799,860 (GRCm39) E145V probably damaging Het
Rasef C T 4: 73,653,956 (GRCm39) probably null Het
Rcbtb1 T G 14: 59,472,699 (GRCm39) I496S probably benign Het
Rcor1 T C 12: 111,066,393 (GRCm39) Y228H Het
Reep5 C T 18: 34,490,222 (GRCm39) V92I probably damaging Het
Rfx3 T C 19: 27,827,329 (GRCm39) S86G probably benign Het
Rptn T A 3: 93,304,384 (GRCm39) D572E probably benign Het
Rsl1 A T 13: 67,324,510 (GRCm39) probably null Het
Sbf2 T C 7: 109,914,292 (GRCm39) E1630G possibly damaging Het
Sele G A 1: 163,876,975 (GRCm39) V84I probably benign Het
Serpina1b T C 12: 103,698,756 (GRCm39) D31G probably benign Het
Serpina3c T C 12: 104,115,813 (GRCm39) I244V probably benign Het
Serpinb6e A G 13: 34,017,204 (GRCm39) V272A probably benign Het
Serpinb9b A G 13: 33,219,523 (GRCm39) D150G probably benign Het
Sgpp1 T C 12: 75,769,374 (GRCm39) T265A probably benign Het
Slc9a1 T A 4: 133,143,681 (GRCm39) M389K probably damaging Het
Slco3a1 A T 7: 74,204,236 (GRCm39) C35S probably damaging Het
Slco6d1 T A 1: 98,427,619 (GRCm39) V650E possibly damaging Het
Slit2 T C 5: 48,349,568 (GRCm39) V274A possibly damaging Het
Snd1 A G 6: 28,795,936 (GRCm39) E593G probably null Het
Spata2l C T 8: 123,960,873 (GRCm39) V139M probably benign Het
Suco T C 1: 161,684,427 (GRCm39) K231R probably damaging Het
Tenm3 C A 8: 49,008,935 (GRCm39) probably benign Het
Tg T C 15: 66,699,118 (GRCm39) S2415P possibly damaging Het
Traf6 C A 2: 101,527,072 (GRCm39) A274D possibly damaging Het
Usp14 A G 18: 9,996,239 (GRCm39) I447T possibly damaging Het
Vcpip1 T C 1: 9,817,927 (GRCm39) N152S possibly damaging Het
Vgf A G 5: 137,061,110 (GRCm39) Q424R probably benign Het
Vmn2r84 A T 10: 130,227,993 (GRCm39) M81K possibly damaging Het
Washc5 G A 15: 59,218,067 (GRCm39) A732V possibly damaging Het
Xrcc3 T G 12: 111,771,485 (GRCm39) D213A probably damaging Het
Zeb2 T C 2: 44,886,988 (GRCm39) T690A probably benign Het
Zfat G A 15: 67,956,250 (GRCm39) S1212L probably damaging Het
Zfp623 C T 15: 75,819,949 (GRCm39) L302F probably damaging Het
Zfp799 A C 17: 33,039,733 (GRCm39) C178G possibly damaging Het
Zfy1 T C Y: 727,634 (GRCm39) E348G unknown Het
Zhx3 A G 2: 160,621,393 (GRCm39) W925R possibly damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84,885,252 (GRCm39) missense probably damaging 1.00
IGL00701:Usp32 APN 11 84,949,951 (GRCm39) splice site probably null
IGL00848:Usp32 APN 11 84,942,007 (GRCm39) splice site probably benign
IGL00934:Usp32 APN 11 84,897,902 (GRCm39) missense probably damaging 1.00
IGL01019:Usp32 APN 11 84,930,091 (GRCm39) missense probably damaging 0.97
IGL01302:Usp32 APN 11 84,879,308 (GRCm39) missense probably benign 0.05
IGL01444:Usp32 APN 11 84,949,990 (GRCm39) missense probably damaging 0.97
IGL01575:Usp32 APN 11 84,913,628 (GRCm39) missense probably damaging 1.00
IGL01981:Usp32 APN 11 84,927,350 (GRCm39) missense probably benign 0.02
IGL02118:Usp32 APN 11 84,923,003 (GRCm39) nonsense probably null
IGL02159:Usp32 APN 11 84,896,628 (GRCm39) splice site probably null
IGL02227:Usp32 APN 11 84,877,307 (GRCm39) missense probably damaging 1.00
IGL02363:Usp32 APN 11 84,935,613 (GRCm39) missense probably benign 0.01
IGL02524:Usp32 APN 11 84,900,837 (GRCm39) nonsense probably null
IGL02613:Usp32 APN 11 84,930,896 (GRCm39) missense probably damaging 0.99
IGL02720:Usp32 APN 11 84,897,817 (GRCm39) critical splice donor site probably null
IGL02738:Usp32 APN 11 84,974,632 (GRCm39) missense probably damaging 1.00
IGL02929:Usp32 APN 11 84,879,198 (GRCm39) missense probably benign 0.01
IGL03303:Usp32 APN 11 84,913,658 (GRCm39) missense probably damaging 1.00
BB010:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
BB020:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 84,900,900 (GRCm39) missense probably damaging 1.00
R0026:Usp32 UTSW 11 84,922,900 (GRCm39) missense possibly damaging 0.48
R0295:Usp32 UTSW 11 84,944,518 (GRCm39) missense probably damaging 0.98
R1320:Usp32 UTSW 11 84,908,619 (GRCm39) missense probably damaging 0.98
R1712:Usp32 UTSW 11 84,933,406 (GRCm39) missense probably benign 0.12
R1922:Usp32 UTSW 11 84,897,830 (GRCm39) nonsense probably null
R1973:Usp32 UTSW 11 84,994,757 (GRCm39) missense probably benign 0.09
R2010:Usp32 UTSW 11 84,930,830 (GRCm39) missense probably damaging 0.98
R2082:Usp32 UTSW 11 84,921,338 (GRCm39) missense probably damaging 0.99
R2355:Usp32 UTSW 11 84,896,735 (GRCm39) missense probably benign 0.34
R3147:Usp32 UTSW 11 84,919,913 (GRCm39) missense probably damaging 1.00
R3160:Usp32 UTSW 11 84,916,362 (GRCm39) missense probably damaging 0.97
R3162:Usp32 UTSW 11 84,916,362 (GRCm39) missense probably damaging 0.97
R3716:Usp32 UTSW 11 84,933,389 (GRCm39) missense probably damaging 1.00
R3816:Usp32 UTSW 11 84,885,210 (GRCm39) critical splice donor site probably null
R3870:Usp32 UTSW 11 84,897,881 (GRCm39) nonsense probably null
R3871:Usp32 UTSW 11 84,971,982 (GRCm39) missense probably null 0.81
R4041:Usp32 UTSW 11 84,908,565 (GRCm39) missense probably benign 0.40
R4079:Usp32 UTSW 11 84,930,055 (GRCm39) missense probably damaging 0.98
R4332:Usp32 UTSW 11 84,994,804 (GRCm39) missense possibly damaging 0.79
R4396:Usp32 UTSW 11 84,944,801 (GRCm39) missense probably benign
R4580:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably null
R4620:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably null
R4744:Usp32 UTSW 11 84,885,219 (GRCm39) missense probably damaging 1.00
R4909:Usp32 UTSW 11 84,946,598 (GRCm39) nonsense probably null
R5056:Usp32 UTSW 11 84,917,621 (GRCm39) missense probably benign 0.07
R5111:Usp32 UTSW 11 84,968,157 (GRCm39) missense possibly damaging 0.95
R5213:Usp32 UTSW 11 84,913,085 (GRCm39) missense probably damaging 1.00
R5308:Usp32 UTSW 11 84,908,544 (GRCm39) missense probably benign 0.12
R5381:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably benign
R5538:Usp32 UTSW 11 84,908,612 (GRCm39) missense possibly damaging 0.65
R5659:Usp32 UTSW 11 84,968,240 (GRCm39) missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84,883,277 (GRCm39) critical splice donor site probably null
R6011:Usp32 UTSW 11 84,922,923 (GRCm39) missense possibly damaging 0.70
R6029:Usp32 UTSW 11 84,916,408 (GRCm39) missense probably damaging 0.99
R6074:Usp32 UTSW 11 84,885,399 (GRCm39) missense probably benign 0.00
R6331:Usp32 UTSW 11 84,877,402 (GRCm39) missense possibly damaging 0.92
R6353:Usp32 UTSW 11 84,913,107 (GRCm39) missense probably benign
R6714:Usp32 UTSW 11 84,917,696 (GRCm39) missense probably damaging 0.99
R6778:Usp32 UTSW 11 84,916,512 (GRCm39) missense probably benign 0.00
R6988:Usp32 UTSW 11 84,900,969 (GRCm39) missense probably benign 0.35
R6992:Usp32 UTSW 11 84,922,914 (GRCm39) missense probably damaging 0.99
R7182:Usp32 UTSW 11 84,930,996 (GRCm39) missense probably benign 0.34
R7186:Usp32 UTSW 11 84,942,060 (GRCm39) missense probably benign 0.45
R7198:Usp32 UTSW 11 84,913,681 (GRCm39) frame shift probably null
R7201:Usp32 UTSW 11 84,913,681 (GRCm39) frame shift probably null
R7469:Usp32 UTSW 11 84,879,379 (GRCm39) missense possibly damaging 0.94
R7502:Usp32 UTSW 11 84,913,724 (GRCm39) missense possibly damaging 0.48
R7513:Usp32 UTSW 11 84,917,938 (GRCm39) nonsense probably null
R7629:Usp32 UTSW 11 84,910,681 (GRCm39) frame shift probably null
R7703:Usp32 UTSW 11 84,968,153 (GRCm39) missense probably damaging 0.99
R7741:Usp32 UTSW 11 84,878,107 (GRCm39) missense probably damaging 0.99
R7765:Usp32 UTSW 11 84,885,234 (GRCm39) missense probably damaging 1.00
R7933:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
R7973:Usp32 UTSW 11 84,913,634 (GRCm39) missense probably damaging 0.99
R7989:Usp32 UTSW 11 84,925,126 (GRCm39) missense
R7998:Usp32 UTSW 11 84,885,252 (GRCm39) missense probably damaging 1.00
R8292:Usp32 UTSW 11 84,968,227 (GRCm39) missense probably damaging 0.99
R8305:Usp32 UTSW 11 84,923,011 (GRCm39) missense possibly damaging 0.83
R8548:Usp32 UTSW 11 84,908,653 (GRCm39) missense possibly damaging 0.52
R8924:Usp32 UTSW 11 84,916,370 (GRCm39) missense probably damaging 0.98
R9002:Usp32 UTSW 11 84,944,777 (GRCm39) missense probably damaging 0.96
R9145:Usp32 UTSW 11 84,913,118 (GRCm39) missense probably damaging 1.00
R9209:Usp32 UTSW 11 84,930,838 (GRCm39) missense probably damaging 0.98
R9211:Usp32 UTSW 11 84,913,559 (GRCm39) missense probably damaging 1.00
R9296:Usp32 UTSW 11 84,908,478 (GRCm39) missense probably damaging 1.00
R9417:Usp32 UTSW 11 84,885,369 (GRCm39) missense probably damaging 1.00
R9514:Usp32 UTSW 11 84,913,560 (GRCm39) missense probably damaging 0.99
R9652:Usp32 UTSW 11 84,921,317 (GRCm39) missense probably damaging 0.97
R9723:Usp32 UTSW 11 84,935,536 (GRCm39) nonsense probably null
R9757:Usp32 UTSW 11 84,968,155 (GRCm39) nonsense probably null
X0028:Usp32 UTSW 11 84,883,432 (GRCm39) missense probably benign 0.05
Z1177:Usp32 UTSW 11 84,879,438 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTGTCAAGAAGAGACCAATTTCC -3'
(R):5'- GTATCTTCTGTATATCACTGGCTTG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CACTGGCTTGCTTTTGAAAATATTTC -3'
Posted On 2022-03-25