Incidental Mutation 'R9310:Xrcc3'
ID 705497
Institutional Source Beutler Lab
Gene Symbol Xrcc3
Ensembl Gene ENSMUSG00000021287
Gene Name X-ray repair complementing defective repair in Chinese hamster cells 3
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 111803192-111813873 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 111805051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 213 (D213A)
Ref Sequence ENSEMBL: ENSMUSP00000021715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021715] [ENSMUST00000084941] [ENSMUST00000122300] [ENSMUST00000127281] [ENSMUST00000134578]
AlphaFold Q9CXE6
Predicted Effect probably damaging
Transcript: ENSMUST00000021715
AA Change: D213A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021715
Gene: ENSMUSG00000021287
AA Change: D213A

DomainStartEndE-ValueType
Pfam:Rad51 64 343 1.2e-25 PFAM
Pfam:AAA_25 70 261 2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084941
SMART Domains Protein: ENSMUSP00000082004
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
coiled coil region 86 156 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
Pfam:TPR_10 212 253 3.1e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122300
SMART Domains Protein: ENSMUSP00000113997
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:Rab5-bind 80 254 1e-68 PFAM
Pfam:TPR_10 212 253 8.4e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 2.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127281
SMART Domains Protein: ENSMUSP00000118040
Gene: ENSMUSG00000021287

DomainStartEndE-ValueType
Pfam:Rad51 64 193 4e-17 PFAM
Pfam:AAA_25 70 192 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134578
SMART Domains Protein: ENSMUSP00000120491
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:TPR_1 1 25 1.9e-4 PFAM
Pfam:TPR_7 1 36 1.9e-4 PFAM
Pfam:TPR_10 75 112 7.8e-9 PFAM
Pfam:TPR_1 77 98 1.4e-4 PFAM
Pfam:TPR_7 78 129 1.7e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. Allelic variants in the human gene are associated with susceptibility to breast cancer and cutaneous malignant melanoma. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 116,972,120 I83V possibly damaging Het
Abcf1 G A 17: 35,961,729 A288V probably null Het
Acer1 A T 17: 56,955,598 V184D probably damaging Het
Apoh T C 11: 108,407,481 probably null Het
Arid1a T C 4: 133,686,314 Y959C unknown Het
Asb3 A T 11: 31,028,962 H84L probably benign Het
Atxn1 A C 13: 45,568,018 Y134D probably damaging Het
BC055324 A G 1: 163,964,520 C610R probably damaging Het
Btbd1 T C 7: 81,829,237 Y52C probably damaging Het
Cabp2 A G 19: 4,086,464 D170G probably damaging Het
Cacna1a C A 8: 84,536,417 A407E probably damaging Het
Cacna2d4 T A 6: 119,271,953 probably null Het
Cc2d2a T C 5: 43,695,146 F404S probably damaging Het
Cdh20 T C 1: 104,947,336 M281T probably damaging Het
Cfap54 A T 10: 92,962,315 M1694K unknown Het
Chd6 G T 2: 161,039,261 T261K probably damaging Het
Cnksr1 T C 4: 134,229,019 S585G probably damaging Het
Cntnap2 A T 6: 46,001,347 Y312F probably damaging Het
Coa7 T A 4: 108,338,313 Y146* probably null Het
Col28a1 T C 6: 8,175,414 K145E unknown Het
Coq8b T A 7: 27,242,061 I221N probably damaging Het
Cpd A T 11: 76,814,781 L375* probably null Het
Dnah5 T C 15: 28,448,433 F4214S probably damaging Het
Dock2 A G 11: 34,294,139 F1067S possibly damaging Het
Dpp6 G A 5: 27,631,441 A310T probably damaging Het
Dpp6 C A 5: 27,725,644 L825I probably benign Het
Efcab5 A G 11: 77,113,705 V929A probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Espl1 G A 15: 102,296,850 probably null Het
Gm4847 T C 1: 166,632,712 R402G probably benign Het
Grid1 T C 14: 35,026,805 L194S probably damaging Het
Heatr1 A T 13: 12,438,610 H2122L probably benign Het
Il17b T A 18: 61,692,263 C123* probably null Het
Il17rc T C 6: 113,474,249 L181P probably damaging Het
Inpp5e T A 2: 26,397,928 I619L probably benign Het
Itgax C A 7: 128,142,260 Y814* probably null Het
Marcks C T 10: 37,136,491 E183K unknown Het
Mefv T C 16: 3,715,388 T340A probably benign Het
Mical2 A G 7: 112,351,713 K958R probably benign Het
Mkl2 T A 16: 13,401,090 D533E probably benign Het
Mtor T A 4: 148,469,377 L811Q probably benign Het
Myh4 A G 11: 67,254,744 Y1351C probably damaging Het
Neb T C 2: 52,263,696 M2406V probably benign Het
Nebl T C 2: 17,348,867 T214A probably benign Het
Nlrx1 A T 9: 44,253,408 I913N probably damaging Het
Npr2 G T 4: 43,632,404 A74S probably benign Het
Olfr1220 T A 2: 89,097,913 S5C probably damaging Het
Olfr711 C A 7: 106,971,471 C291F probably damaging Het
Olfr794 T A 10: 129,570,818 N54K probably benign Het
Pard3b G T 1: 62,166,369 V441F probably damaging Het
Pcsk1 G A 13: 75,090,072 R4K probably benign Het
Pisd G T 5: 32,737,440 N337K possibly damaging Het
Pml T C 9: 58,249,662 K10R probably benign Het
Prkci T C 3: 31,029,515 W132R probably damaging Het
Prrc2a A T 17: 35,155,999 M1225K probably benign Het
Prss23 T C 7: 89,509,934 D309G probably damaging Het
Pxdn G A 12: 30,002,052 G743S probably damaging Het
Rab29 A T 1: 131,872,122 E145V probably damaging Het
Rasef C T 4: 73,735,719 probably null Het
Rcbtb1 T G 14: 59,235,250 I496S probably benign Het
Rcor1 T C 12: 111,099,959 Y228H Het
Reep5 C T 18: 34,357,169 V92I probably damaging Het
Rfx3 T C 19: 27,849,929 S86G probably benign Het
Rptn T A 3: 93,397,077 D572E probably benign Het
Rsl1 A T 13: 67,176,446 probably null Het
Sbf2 T C 7: 110,315,085 E1630G possibly damaging Het
Sele G A 1: 164,049,406 V84I probably benign Het
Serpina1b T C 12: 103,732,497 D31G probably benign Het
Serpina3c T C 12: 104,149,554 I244V probably benign Het
Serpinb6e A G 13: 33,833,221 V272A probably benign Het
Serpinb9b A G 13: 33,035,540 D150G probably benign Het
Sgpp1 T C 12: 75,722,600 T265A probably benign Het
Slc9a1 T A 4: 133,416,370 M389K probably damaging Het
Slco3a1 A T 7: 74,554,488 C35S probably damaging Het
Slco6d1 T A 1: 98,499,894 V650E possibly damaging Het
Slit2 T C 5: 48,192,226 V274A possibly damaging Het
Snd1 A G 6: 28,795,937 E593G probably null Het
Spata2l C T 8: 123,234,134 V139M probably benign Het
Suco T C 1: 161,856,858 K231R probably damaging Het
Tenm3 C A 8: 48,555,900 probably benign Het
Tg T C 15: 66,827,269 S2415P possibly damaging Het
Traf6 C A 2: 101,696,727 A274D possibly damaging Het
Usp14 A G 18: 9,996,239 I447T possibly damaging Het
Usp32 G A 11: 85,051,202 L355F probably benign Het
Vcpip1 T C 1: 9,747,702 N152S possibly damaging Het
Vgf A G 5: 137,032,256 Q424R probably benign Het
Vmn2r84 A T 10: 130,392,124 M81K possibly damaging Het
Washc5 G A 15: 59,346,218 A732V possibly damaging Het
Wdr63 C T 3: 146,097,140 probably null Het
Zeb2 T C 2: 44,996,976 T690A probably benign Het
Zfat G A 15: 68,084,401 S1212L probably damaging Het
Zfp623 C T 15: 75,948,100 L302F probably damaging Het
Zfp799 A C 17: 32,820,759 C178G possibly damaging Het
Zfy1 T C Y: 727,634 E348G unknown Het
Zhx3 A G 2: 160,779,473 W925R possibly damaging Het
Other mutations in Xrcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0396:Xrcc3 UTSW 12 111809957 missense probably benign 0.00
R4534:Xrcc3 UTSW 12 111804532 missense probably damaging 0.99
R4535:Xrcc3 UTSW 12 111804532 missense probably damaging 0.99
R5406:Xrcc3 UTSW 12 111812111 missense probably damaging 0.99
R5762:Xrcc3 UTSW 12 111804610 missense probably damaging 0.97
R5842:Xrcc3 UTSW 12 111804530 missense possibly damaging 0.94
R5937:Xrcc3 UTSW 12 111807972 missense probably null 0.51
R6985:Xrcc3 UTSW 12 111812096 missense probably damaging 0.98
R7011:Xrcc3 UTSW 12 111804535 missense probably damaging 1.00
R7560:Xrcc3 UTSW 12 111807902 missense probably benign 0.00
R8680:Xrcc3 UTSW 12 111807879 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCTTTCCCCATGGTCAAGG -3'
(R):5'- TGACCTCAGTATCTGCATGGGAC -3'

Sequencing Primer
(F):5'- ATGGTCAAGGGCAGCCC -3'
(R):5'- TGCAGGTCCAGGTATGAGC -3'
Posted On 2022-03-25