Incidental Mutation 'R9310:Heatr1'
ID 705498
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene Name HEAT repeat containing 1
Synonyms B130016L12Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 12395027-12440289 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12438610 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 2122 (H2122L)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000099820] [ENSMUST00000099821] [ENSMUST00000124888] [ENSMUST00000135166] [ENSMUST00000143693] [ENSMUST00000144283]
AlphaFold G3X9B1
Predicted Effect probably benign
Transcript: ENSMUST00000059270
AA Change: H2122L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: H2122L

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099820
SMART Domains Protein: ENSMUSP00000097408
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099821
SMART Domains Protein: ENSMUSP00000097409
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124888
SMART Domains Protein: ENSMUSP00000115094
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135166
SMART Domains Protein: ENSMUSP00000120210
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143693
SMART Domains Protein: ENSMUSP00000118925
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144283
SMART Domains Protein: ENSMUSP00000114200
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 193 325 1.38e-48 SMART
Gal-bind_lectin 199 324 1.28e-49 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 116,972,120 I83V possibly damaging Het
Abcf1 G A 17: 35,961,729 A288V probably null Het
Acer1 A T 17: 56,955,598 V184D probably damaging Het
Apoh T C 11: 108,407,481 probably null Het
Arid1a T C 4: 133,686,314 Y959C unknown Het
Asb3 A T 11: 31,028,962 H84L probably benign Het
Atxn1 A C 13: 45,568,018 Y134D probably damaging Het
BC055324 A G 1: 163,964,520 C610R probably damaging Het
Btbd1 T C 7: 81,829,237 Y52C probably damaging Het
Cabp2 A G 19: 4,086,464 D170G probably damaging Het
Cacna1a C A 8: 84,536,417 A407E probably damaging Het
Cacna2d4 T A 6: 119,271,953 probably null Het
Cc2d2a T C 5: 43,695,146 F404S probably damaging Het
Cdh20 T C 1: 104,947,336 M281T probably damaging Het
Cfap54 A T 10: 92,962,315 M1694K unknown Het
Chd6 G T 2: 161,039,261 T261K probably damaging Het
Cnksr1 T C 4: 134,229,019 S585G probably damaging Het
Cntnap2 A T 6: 46,001,347 Y312F probably damaging Het
Coa7 T A 4: 108,338,313 Y146* probably null Het
Col28a1 T C 6: 8,175,414 K145E unknown Het
Coq8b T A 7: 27,242,061 I221N probably damaging Het
Cpd A T 11: 76,814,781 L375* probably null Het
Dnah5 T C 15: 28,448,433 F4214S probably damaging Het
Dock2 A G 11: 34,294,139 F1067S possibly damaging Het
Dpp6 G A 5: 27,631,441 A310T probably damaging Het
Dpp6 C A 5: 27,725,644 L825I probably benign Het
Efcab5 A G 11: 77,113,705 V929A probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Espl1 G A 15: 102,296,850 probably null Het
Gm4847 T C 1: 166,632,712 R402G probably benign Het
Grid1 T C 14: 35,026,805 L194S probably damaging Het
Il17b T A 18: 61,692,263 C123* probably null Het
Il17rc T C 6: 113,474,249 L181P probably damaging Het
Inpp5e T A 2: 26,397,928 I619L probably benign Het
Itgax C A 7: 128,142,260 Y814* probably null Het
Marcks C T 10: 37,136,491 E183K unknown Het
Mefv T C 16: 3,715,388 T340A probably benign Het
Mical2 A G 7: 112,351,713 K958R probably benign Het
Mkl2 T A 16: 13,401,090 D533E probably benign Het
Mtor T A 4: 148,469,377 L811Q probably benign Het
Myh4 A G 11: 67,254,744 Y1351C probably damaging Het
Neb T C 2: 52,263,696 M2406V probably benign Het
Nebl T C 2: 17,348,867 T214A probably benign Het
Nlrx1 A T 9: 44,253,408 I913N probably damaging Het
Npr2 G T 4: 43,632,404 A74S probably benign Het
Olfr1220 T A 2: 89,097,913 S5C probably damaging Het
Olfr711 C A 7: 106,971,471 C291F probably damaging Het
Olfr794 T A 10: 129,570,818 N54K probably benign Het
Pard3b G T 1: 62,166,369 V441F probably damaging Het
Pcsk1 G A 13: 75,090,072 R4K probably benign Het
Pisd G T 5: 32,737,440 N337K possibly damaging Het
Pml T C 9: 58,249,662 K10R probably benign Het
Prkci T C 3: 31,029,515 W132R probably damaging Het
Prrc2a A T 17: 35,155,999 M1225K probably benign Het
Prss23 T C 7: 89,509,934 D309G probably damaging Het
Pxdn G A 12: 30,002,052 G743S probably damaging Het
Rab29 A T 1: 131,872,122 E145V probably damaging Het
Rasef C T 4: 73,735,719 probably null Het
Rcbtb1 T G 14: 59,235,250 I496S probably benign Het
Rcor1 T C 12: 111,099,959 Y228H Het
Reep5 C T 18: 34,357,169 V92I probably damaging Het
Rfx3 T C 19: 27,849,929 S86G probably benign Het
Rptn T A 3: 93,397,077 D572E probably benign Het
Rsl1 A T 13: 67,176,446 probably null Het
Sbf2 T C 7: 110,315,085 E1630G possibly damaging Het
Sele G A 1: 164,049,406 V84I probably benign Het
Serpina1b T C 12: 103,732,497 D31G probably benign Het
Serpina3c T C 12: 104,149,554 I244V probably benign Het
Serpinb6e A G 13: 33,833,221 V272A probably benign Het
Serpinb9b A G 13: 33,035,540 D150G probably benign Het
Sgpp1 T C 12: 75,722,600 T265A probably benign Het
Slc9a1 T A 4: 133,416,370 M389K probably damaging Het
Slco3a1 A T 7: 74,554,488 C35S probably damaging Het
Slco6d1 T A 1: 98,499,894 V650E possibly damaging Het
Slit2 T C 5: 48,192,226 V274A possibly damaging Het
Snd1 A G 6: 28,795,937 E593G probably null Het
Spata2l C T 8: 123,234,134 V139M probably benign Het
Suco T C 1: 161,856,858 K231R probably damaging Het
Tenm3 C A 8: 48,555,900 probably benign Het
Tg T C 15: 66,827,269 S2415P possibly damaging Het
Traf6 C A 2: 101,696,727 A274D possibly damaging Het
Usp14 A G 18: 9,996,239 I447T possibly damaging Het
Usp32 G A 11: 85,051,202 L355F probably benign Het
Vcpip1 T C 1: 9,747,702 N152S possibly damaging Het
Vgf A G 5: 137,032,256 Q424R probably benign Het
Vmn2r84 A T 10: 130,392,124 M81K possibly damaging Het
Washc5 G A 15: 59,346,218 A732V possibly damaging Het
Wdr63 C T 3: 146,097,140 probably null Het
Xrcc3 T G 12: 111,805,051 D213A probably damaging Het
Zeb2 T C 2: 44,996,976 T690A probably benign Het
Zfat G A 15: 68,084,401 S1212L probably damaging Het
Zfp623 C T 15: 75,948,100 L302F probably damaging Het
Zfp799 A C 17: 32,820,759 C178G possibly damaging Het
Zfy1 T C Y: 727,634 E348G unknown Het
Zhx3 A G 2: 160,779,473 W925R possibly damaging Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12421060 nonsense probably null
R7445:Heatr1 UTSW 13 12431038 missense possibly damaging 0.70
R7669:Heatr1 UTSW 13 12411262 missense probably benign 0.33
R7672:Heatr1 UTSW 13 12438664 missense probably damaging 0.96
R7772:Heatr1 UTSW 13 12417641 missense probably benign 0.03
R8205:Heatr1 UTSW 13 12416047 missense probably benign
R8518:Heatr1 UTSW 13 12410534 missense probably benign
R8754:Heatr1 UTSW 13 12413294 missense probably damaging 0.99
R8874:Heatr1 UTSW 13 12430912 missense probably damaging 1.00
R8992:Heatr1 UTSW 13 12401114 missense probably damaging 0.98
R9045:Heatr1 UTSW 13 12413352 missense probably benign 0.00
R9077:Heatr1 UTSW 13 12413366 missense probably benign
R9183:Heatr1 UTSW 13 12421385 missense probably damaging 0.99
R9186:Heatr1 UTSW 13 12421346 missense probably damaging 1.00
R9223:Heatr1 UTSW 13 12404921 missense probably benign 0.00
R9242:Heatr1 UTSW 13 12433925 missense probably benign
R9267:Heatr1 UTSW 13 12406608 missense probably damaging 1.00
R9289:Heatr1 UTSW 13 12432727 missense probably benign 0.13
R9312:Heatr1 UTSW 13 12431684 missense probably benign
R9358:Heatr1 UTSW 13 12418206 missense probably benign 0.09
R9385:Heatr1 UTSW 13 12406542 missense probably damaging 1.00
R9530:Heatr1 UTSW 13 12424726 missense probably damaging 1.00
R9532:Heatr1 UTSW 13 12414425 missense possibly damaging 0.72
RF011:Heatr1 UTSW 13 12407544 missense probably benign 0.00
Z1176:Heatr1 UTSW 13 12399008 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CCAAGAACAAGTACATGCCTGTG -3'
(R):5'- GGATTCTGTGGTATCCCAGAC -3'

Sequencing Primer
(F):5'- CAAGTACATGCCTGTGAGGAGTG -3'
(R):5'- TCCCAGACAGGCAGGGATTTTG -3'
Posted On 2022-03-25