Mutagenetix > Incidental Mutation

Incidental Mutation 'R9310:Atxn1'

705501

Institutional Source

Beutler Lab

Gene Symbol

Atxn1

Ensembl Gene

ENSMUSG00000046876

Gene Name

ataxin 1

Synonyms

2900016G23Rik, Atx1, Sca1

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9310 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45549755-45965008 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 45568018 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 134 (Y134D)

Ref Sequence

ENSEMBL: ENSMUSP00000137439 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091628] [ENSMUST00000167708] [ENSMUST00000180110]

AlphaFold

P54254

Predicted Effect

probably damaging
Transcript: ENSMUST00000091628
AA Change: Y134D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089217
Gene: ENSMUSG00000046876
AA Change: Y134D

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	153	168	N/A	INTRINSIC
Pfam:ATXN-1_C	391	421	8.7e-15	PFAM
AXH	545	664	1.42e-82	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167708
AA Change: Y134D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129890
Gene: ENSMUSG00000046876
AA Change: Y134D

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	153	168	N/A	INTRINSIC
Pfam:ATXN-1_C	391	421	8.7e-15	PFAM
AXH	545	664	1.42e-82	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000180110
AA Change: Y134D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137439
Gene: ENSMUSG00000046876
AA Change: Y134D

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	153	168	N/A	INTRINSIC
Pfam:ATXN-1_C	402	421	3e-10	PFAM
low complexity region	537	548	N/A	INTRINSIC
Pfam:AXH	550	671	1.1e-44	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). At least two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased exploration, impaired spatial working memory, impaired coordination, and decreased paired-pulse facilitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030J22Rik	T	C	8: 116,972,120	I83V	possibly damaging	Het
Abcf1	G	A	17: 35,961,729	A288V	probably null	Het
Acer1	A	T	17: 56,955,598	V184D	probably damaging	Het
Apoh	T	C	11: 108,407,481		probably null	Het
Arid1a	T	C	4: 133,686,314	Y959C	unknown	Het
Asb3	A	T	11: 31,028,962	H84L	probably benign	Het
BC055324	A	G	1: 163,964,520	C610R	probably damaging	Het
Btbd1	T	C	7: 81,829,237	Y52C	probably damaging	Het
Cabp2	A	G	19: 4,086,464	D170G	probably damaging	Het
Cacna1a	C	A	8: 84,536,417	A407E	probably damaging	Het
Cacna2d4	T	A	6: 119,271,953		probably null	Het
Cc2d2a	T	C	5: 43,695,146	F404S	probably damaging	Het
Cdh20	T	C	1: 104,947,336	M281T	probably damaging	Het
Cfap54	A	T	10: 92,962,315	M1694K	unknown	Het
Chd6	G	T	2: 161,039,261	T261K	probably damaging	Het
Cnksr1	T	C	4: 134,229,019	S585G	probably damaging	Het
Cntnap2	A	T	6: 46,001,347	Y312F	probably damaging	Het
Coa7	T	A	4: 108,338,313	Y146*	probably null	Het
Col28a1	T	C	6: 8,175,414	K145E	unknown	Het
Coq8b	T	A	7: 27,242,061	I221N	probably damaging	Het
Cpd	A	T	11: 76,814,781	L375*	probably null	Het
Dnah5	T	C	15: 28,448,433	F4214S	probably damaging	Het
Dock2	A	G	11: 34,294,139	F1067S	possibly damaging	Het
Dpp6	G	A	5: 27,631,441	A310T	probably damaging	Het
Dpp6	C	A	5: 27,725,644	L825I	probably benign	Het
Efcab5	A	G	11: 77,113,705	V929A	probably benign	Het
Ephx3	C	G	17: 32,189,316	D45H	probably benign	Het
Espl1	G	A	15: 102,296,850		probably null	Het
Gm4847	T	C	1: 166,632,712	R402G	probably benign	Het
Grid1	T	C	14: 35,026,805	L194S	probably damaging	Het
Heatr1	A	T	13: 12,438,610	H2122L	probably benign	Het
Il17b	T	A	18: 61,692,263	C123*	probably null	Het
Il17rc	T	C	6: 113,474,249	L181P	probably damaging	Het
Inpp5e	T	A	2: 26,397,928	I619L	probably benign	Het
Itgax	C	A	7: 128,142,260	Y814*	probably null	Het
Marcks	C	T	10: 37,136,491	E183K	unknown	Het
Mefv	T	C	16: 3,715,388	T340A	probably benign	Het
Mical2	A	G	7: 112,351,713	K958R	probably benign	Het
Mkl2	T	A	16: 13,401,090	D533E	probably benign	Het
Mtor	T	A	4: 148,469,377	L811Q	probably benign	Het
Myh4	A	G	11: 67,254,744	Y1351C	probably damaging	Het
Neb	T	C	2: 52,263,696	M2406V	probably benign	Het
Nebl	T	C	2: 17,348,867	T214A	probably benign	Het
Nlrx1	A	T	9: 44,253,408	I913N	probably damaging	Het
Npr2	G	T	4: 43,632,404	A74S	probably benign	Het
Olfr1220	T	A	2: 89,097,913	S5C	probably damaging	Het
Olfr711	C	A	7: 106,971,471	C291F	probably damaging	Het
Olfr794	T	A	10: 129,570,818	N54K	probably benign	Het
Pard3b	G	T	1: 62,166,369	V441F	probably damaging	Het
Pcsk1	G	A	13: 75,090,072	R4K	probably benign	Het
Pisd	G	T	5: 32,737,440	N337K	possibly damaging	Het
Pml	T	C	9: 58,249,662	K10R	probably benign	Het
Prkci	T	C	3: 31,029,515	W132R	probably damaging	Het
Prrc2a	A	T	17: 35,155,999	M1225K	probably benign	Het
Prss23	T	C	7: 89,509,934	D309G	probably damaging	Het
Pxdn	G	A	12: 30,002,052	G743S	probably damaging	Het
Rab29	A	T	1: 131,872,122	E145V	probably damaging	Het
Rasef	C	T	4: 73,735,719		probably null	Het
Rcbtb1	T	G	14: 59,235,250	I496S	probably benign	Het
Rcor1	T	C	12: 111,099,959	Y228H		Het
Reep5	C	T	18: 34,357,169	V92I	probably damaging	Het
Rfx3	T	C	19: 27,849,929	S86G	probably benign	Het
Rptn	T	A	3: 93,397,077	D572E	probably benign	Het
Rsl1	A	T	13: 67,176,446		probably null	Het
Sbf2	T	C	7: 110,315,085	E1630G	possibly damaging	Het
Sele	G	A	1: 164,049,406	V84I	probably benign	Het
Serpina1b	T	C	12: 103,732,497	D31G	probably benign	Het
Serpina3c	T	C	12: 104,149,554	I244V	probably benign	Het
Serpinb6e	A	G	13: 33,833,221	V272A	probably benign	Het
Serpinb9b	A	G	13: 33,035,540	D150G	probably benign	Het
Sgpp1	T	C	12: 75,722,600	T265A	probably benign	Het
Slc9a1	T	A	4: 133,416,370	M389K	probably damaging	Het
Slco3a1	A	T	7: 74,554,488	C35S	probably damaging	Het
Slco6d1	T	A	1: 98,499,894	V650E	possibly damaging	Het
Slit2	T	C	5: 48,192,226	V274A	possibly damaging	Het
Snd1	A	G	6: 28,795,937	E593G	probably null	Het
Spata2l	C	T	8: 123,234,134	V139M	probably benign	Het
Suco	T	C	1: 161,856,858	K231R	probably damaging	Het
Tenm3	C	A	8: 48,555,900		probably benign	Het
Tg	T	C	15: 66,827,269	S2415P	possibly damaging	Het
Traf6	C	A	2: 101,696,727	A274D	possibly damaging	Het
Usp14	A	G	18: 9,996,239	I447T	possibly damaging	Het
Usp32	G	A	11: 85,051,202	L355F	probably benign	Het
Vcpip1	T	C	1: 9,747,702	N152S	possibly damaging	Het
Vgf	A	G	5: 137,032,256	Q424R	probably benign	Het
Vmn2r84	A	T	10: 130,392,124	M81K	possibly damaging	Het
Washc5	G	A	15: 59,346,218	A732V	possibly damaging	Het
Wdr63	C	T	3: 146,097,140		probably null	Het
Xrcc3	T	G	12: 111,805,051	D213A	probably damaging	Het
Zeb2	T	C	2: 44,996,976	T690A	probably benign	Het
Zfat	G	A	15: 68,084,401	S1212L	probably damaging	Het
Zfp623	C	T	15: 75,948,100	L302F	probably damaging	Het
Zfp799	A	C	17: 32,820,759	C178G	possibly damaging	Het
Zfy1	T	C	Y: 727,634	E348G	unknown	Het
Zhx3	A	G	2: 160,779,473	W925R	possibly damaging	Het

Other mutations in Atxn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01374:Atxn1	APN	13	45568427	utr 5 prime	probably benign
IGL01467:Atxn1	APN	13	45567193	missense	probably damaging	1.00
IGL01482:Atxn1	APN	13	45557314	missense	probably benign	0.00
IGL01512:Atxn1	APN	13	45566601	missense	probably damaging	0.99
IGL01735:Atxn1	APN	13	45566722	missense	probably damaging	1.00
IGL02005:Atxn1	APN	13	45568225	missense	probably benign	0.00
IGL02333:Atxn1	APN	13	45567204	missense	probably damaging	1.00
Cormorant	UTSW	13	45557069	missense	probably damaging	1.00
pelagic	UTSW	13	45566812	missense	probably benign	0.05
R0136:Atxn1	UTSW	13	45567169	missense	probably damaging	0.99
R0180:Atxn1	UTSW	13	45557548	missense	probably damaging	1.00
R0299:Atxn1	UTSW	13	45567169	missense	probably damaging	0.99
R0540:Atxn1	UTSW	13	45557530	missense	probably damaging	1.00
R1220:Atxn1	UTSW	13	45557423	missense	probably benign	0.08
R1484:Atxn1	UTSW	13	45557576	nonsense	probably null
R1532:Atxn1	UTSW	13	45566910	missense	possibly damaging	0.95
R1885:Atxn1	UTSW	13	45567804	missense	probably benign	0.27
R2277:Atxn1	UTSW	13	45557068	missense	probably damaging	0.99
R2847:Atxn1	UTSW	13	45566699	missense	probably damaging	1.00
R2849:Atxn1	UTSW	13	45566699	missense	probably damaging	1.00
R4326:Atxn1	UTSW	13	45965967	unclassified	probably benign
R4626:Atxn1	UTSW	13	45567099	missense	probably damaging	1.00
R4768:Atxn1	UTSW	13	45557548	missense	probably damaging	1.00
R4944:Atxn1	UTSW	13	45566931	missense	probably damaging	1.00
R5011:Atxn1	UTSW	13	45557069	missense	probably damaging	1.00
R5061:Atxn1	UTSW	13	45557093	missense	probably damaging	1.00
R5293:Atxn1	UTSW	13	45568368	missense	probably damaging	1.00
R5299:Atxn1	UTSW	13	45557254	missense	probably benign	0.14
R5561:Atxn1	UTSW	13	45566871	missense	possibly damaging	0.49
R5667:Atxn1	UTSW	13	45557377	missense	probably benign	0.17
R6092:Atxn1	UTSW	13	45566812	missense	probably benign	0.05
R6272:Atxn1	UTSW	13	45567762	missense	possibly damaging	0.49
R6372:Atxn1	UTSW	13	45557456	missense	probably damaging	1.00
R6688:Atxn1	UTSW	13	45567671	missense	probably damaging	0.99
R6997:Atxn1	UTSW	13	45567619	missense	probably benign	0.04
R7041:Atxn1	UTSW	13	45566835	missense	probably damaging	1.00
R7578:Atxn1	UTSW	13	45567358	missense	probably benign	0.02
R7600:Atxn1	UTSW	13	45557060	missense	possibly damaging	0.90
R8112:Atxn1	UTSW	13	45567957	missense	probably benign
R8297:Atxn1	UTSW	13	45567029	missense	probably benign
R8411:Atxn1	UTSW	13	45566556	missense	probably benign	0.02
R8482:Atxn1	UTSW	13	45567950	missense	possibly damaging	0.75
R9022:Atxn1	UTSW	13	45567415	missense	probably damaging	1.00
R9269:Atxn1	UTSW	13	45557204	missense	probably benign	0.01
R9514:Atxn1	UTSW	13	45567957	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTGACTAATCCTGCAGCCC -3'
(R):5'- GGTTTACATAAAGCACTGTCCGC -3'

Sequencing Primer
(F):5'- AGGGGGCTCAACCTTATGTC -3'
(R):5'- CGCAGGGCTGGATTACTC -3'

Posted On

2022-03-25