Incidental Mutation 'R9310:Zfat'
ID 705509
Institutional Source Beutler Lab
Gene Symbol Zfat
Ensembl Gene ENSMUSG00000022335
Gene Name zinc finger and AT hook domain containing
Synonyms LOC380993, Zfat1, Zfp406
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 68083764-68258856 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 68084401 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 1212 (S1212L)
Ref Sequence ENSEMBL: ENSMUSP00000125257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160248] [ENSMUST00000162054] [ENSMUST00000162173]
AlphaFold Q7TS63
Predicted Effect probably damaging
Transcript: ENSMUST00000160248
AA Change: S1212L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125257
Gene: ENSMUSG00000022335
AA Change: S1212L

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 220 236 N/A INTRINSIC
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 321 1.18e-2 SMART
ZnF_C2H2 326 349 2.36e-2 SMART
ZnF_C2H2 354 377 4.4e-2 SMART
ZnF_C2H2 404 426 1.67e-2 SMART
ZnF_C2H2 432 454 1.33e-1 SMART
ZnF_C2H2 458 481 2.05e-2 SMART
low complexity region 601 617 N/A INTRINSIC
ZnF_C2H2 737 759 1.43e-1 SMART
ZnF_C2H2 765 788 3.52e-1 SMART
ZnF_C2H2 793 817 5.59e-4 SMART
ZnF_C2H2 825 848 3.83e-2 SMART
ZnF_C2H2 875 898 3.95e1 SMART
ZnF_C2H2 904 926 6.88e-4 SMART
ZnF_C2H2 932 954 8.94e-3 SMART
ZnF_C2H2 961 983 2.27e-4 SMART
ZnF_C2H2 989 1012 9.3e-1 SMART
ZnF_C2H2 1036 1059 5.21e-4 SMART
low complexity region 1073 1082 N/A INTRINSIC
low complexity region 1139 1149 N/A INTRINSIC
low complexity region 1218 1236 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162054
AA Change: S1194L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125732
Gene: ENSMUSG00000022335
AA Change: S1194L

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 264 286 1.47e-3 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
ZnF_C2H2 319 342 2.36e-2 SMART
ZnF_C2H2 347 370 4.4e-2 SMART
ZnF_C2H2 397 419 1.67e-2 SMART
ZnF_C2H2 425 447 1.33e-1 SMART
ZnF_C2H2 451 474 2.05e-2 SMART
low complexity region 594 610 N/A INTRINSIC
ZnF_C2H2 730 752 1.43e-1 SMART
ZnF_C2H2 758 781 3.52e-1 SMART
ZnF_C2H2 786 810 5.59e-4 SMART
ZnF_C2H2 818 841 3.83e-2 SMART
ZnF_C2H2 868 891 3.95e1 SMART
ZnF_C2H2 897 919 6.88e-4 SMART
ZnF_C2H2 925 947 8.94e-3 SMART
ZnF_C2H2 954 976 2.27e-4 SMART
ZnF_C2H2 982 1005 9.3e-1 SMART
ZnF_C2H2 1029 1052 5.21e-4 SMART
low complexity region 1121 1131 N/A INTRINSIC
low complexity region 1200 1218 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162173
AA Change: S1127L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124974
Gene: ENSMUSG00000022335
AA Change: S1127L

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 220 236 N/A INTRINSIC
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 321 1.18e-2 SMART
ZnF_C2H2 326 349 2.36e-2 SMART
ZnF_C2H2 354 377 4.4e-2 SMART
ZnF_C2H2 404 426 1.67e-2 SMART
ZnF_C2H2 432 454 1.33e-1 SMART
ZnF_C2H2 458 481 2.05e-2 SMART
low complexity region 601 617 N/A INTRINSIC
ZnF_C2H2 737 759 1.43e-1 SMART
ZnF_C2H2 765 788 3.52e-1 SMART
ZnF_C2H2 793 817 5.59e-4 SMART
ZnF_C2H2 825 848 3.83e-2 SMART
ZnF_C2H2 875 898 3.95e1 SMART
ZnF_C2H2 904 926 6.88e-4 SMART
ZnF_C2H2 932 954 8.94e-3 SMART
ZnF_C2H2 961 983 2.27e-4 SMART
ZnF_C2H2 989 1012 9.3e-1 SMART
ZnF_C2H2 1036 1059 5.21e-4 SMART
low complexity region 1133 1151 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely binds DNA and functions as a transcriptional regulator involved in apoptosis and cell survival. This gene resides in a susceptibility locus for autoimmune thyroid disease (AITD) on chromosome 8q24. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with failure to initiation of embryo turning, abnormal embryonic hematopoiesis, abnormal spongiotrophoblast layer morphology, abnormal visceral yolk sac blood island morphology and pale yolk sac. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 116,972,120 I83V possibly damaging Het
Abcf1 G A 17: 35,961,729 A288V probably null Het
Acer1 A T 17: 56,955,598 V184D probably damaging Het
Apoh T C 11: 108,407,481 probably null Het
Arid1a T C 4: 133,686,314 Y959C unknown Het
Asb3 A T 11: 31,028,962 H84L probably benign Het
Atxn1 A C 13: 45,568,018 Y134D probably damaging Het
BC055324 A G 1: 163,964,520 C610R probably damaging Het
Btbd1 T C 7: 81,829,237 Y52C probably damaging Het
Cabp2 A G 19: 4,086,464 D170G probably damaging Het
Cacna1a C A 8: 84,536,417 A407E probably damaging Het
Cacna2d4 T A 6: 119,271,953 probably null Het
Cc2d2a T C 5: 43,695,146 F404S probably damaging Het
Cdh20 T C 1: 104,947,336 M281T probably damaging Het
Cfap54 A T 10: 92,962,315 M1694K unknown Het
Chd6 G T 2: 161,039,261 T261K probably damaging Het
Cnksr1 T C 4: 134,229,019 S585G probably damaging Het
Cntnap2 A T 6: 46,001,347 Y312F probably damaging Het
Coa7 T A 4: 108,338,313 Y146* probably null Het
Col28a1 T C 6: 8,175,414 K145E unknown Het
Coq8b T A 7: 27,242,061 I221N probably damaging Het
Cpd A T 11: 76,814,781 L375* probably null Het
Dnah5 T C 15: 28,448,433 F4214S probably damaging Het
Dock2 A G 11: 34,294,139 F1067S possibly damaging Het
Dpp6 G A 5: 27,631,441 A310T probably damaging Het
Dpp6 C A 5: 27,725,644 L825I probably benign Het
Efcab5 A G 11: 77,113,705 V929A probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Espl1 G A 15: 102,296,850 probably null Het
Gm4847 T C 1: 166,632,712 R402G probably benign Het
Grid1 T C 14: 35,026,805 L194S probably damaging Het
Heatr1 A T 13: 12,438,610 H2122L probably benign Het
Il17b T A 18: 61,692,263 C123* probably null Het
Il17rc T C 6: 113,474,249 L181P probably damaging Het
Inpp5e T A 2: 26,397,928 I619L probably benign Het
Itgax C A 7: 128,142,260 Y814* probably null Het
Marcks C T 10: 37,136,491 E183K unknown Het
Mefv T C 16: 3,715,388 T340A probably benign Het
Mical2 A G 7: 112,351,713 K958R probably benign Het
Mkl2 T A 16: 13,401,090 D533E probably benign Het
Mtor T A 4: 148,469,377 L811Q probably benign Het
Myh4 A G 11: 67,254,744 Y1351C probably damaging Het
Neb T C 2: 52,263,696 M2406V probably benign Het
Nebl T C 2: 17,348,867 T214A probably benign Het
Nlrx1 A T 9: 44,253,408 I913N probably damaging Het
Npr2 G T 4: 43,632,404 A74S probably benign Het
Olfr1220 T A 2: 89,097,913 S5C probably damaging Het
Olfr711 C A 7: 106,971,471 C291F probably damaging Het
Olfr794 T A 10: 129,570,818 N54K probably benign Het
Pard3b G T 1: 62,166,369 V441F probably damaging Het
Pcsk1 G A 13: 75,090,072 R4K probably benign Het
Pisd G T 5: 32,737,440 N337K possibly damaging Het
Pml T C 9: 58,249,662 K10R probably benign Het
Prkci T C 3: 31,029,515 W132R probably damaging Het
Prrc2a A T 17: 35,155,999 M1225K probably benign Het
Prss23 T C 7: 89,509,934 D309G probably damaging Het
Pxdn G A 12: 30,002,052 G743S probably damaging Het
Rab29 A T 1: 131,872,122 E145V probably damaging Het
Rasef C T 4: 73,735,719 probably null Het
Rcbtb1 T G 14: 59,235,250 I496S probably benign Het
Rcor1 T C 12: 111,099,959 Y228H Het
Reep5 C T 18: 34,357,169 V92I probably damaging Het
Rfx3 T C 19: 27,849,929 S86G probably benign Het
Rptn T A 3: 93,397,077 D572E probably benign Het
Rsl1 A T 13: 67,176,446 probably null Het
Sbf2 T C 7: 110,315,085 E1630G possibly damaging Het
Sele G A 1: 164,049,406 V84I probably benign Het
Serpina1b T C 12: 103,732,497 D31G probably benign Het
Serpina3c T C 12: 104,149,554 I244V probably benign Het
Serpinb6e A G 13: 33,833,221 V272A probably benign Het
Serpinb9b A G 13: 33,035,540 D150G probably benign Het
Sgpp1 T C 12: 75,722,600 T265A probably benign Het
Slc9a1 T A 4: 133,416,370 M389K probably damaging Het
Slco3a1 A T 7: 74,554,488 C35S probably damaging Het
Slco6d1 T A 1: 98,499,894 V650E possibly damaging Het
Slit2 T C 5: 48,192,226 V274A possibly damaging Het
Snd1 A G 6: 28,795,937 E593G probably null Het
Spata2l C T 8: 123,234,134 V139M probably benign Het
Suco T C 1: 161,856,858 K231R probably damaging Het
Tenm3 C A 8: 48,555,900 probably benign Het
Tg T C 15: 66,827,269 S2415P possibly damaging Het
Traf6 C A 2: 101,696,727 A274D possibly damaging Het
Usp14 A G 18: 9,996,239 I447T possibly damaging Het
Usp32 G A 11: 85,051,202 L355F probably benign Het
Vcpip1 T C 1: 9,747,702 N152S possibly damaging Het
Vgf A G 5: 137,032,256 Q424R probably benign Het
Vmn2r84 A T 10: 130,392,124 M81K possibly damaging Het
Washc5 G A 15: 59,346,218 A732V possibly damaging Het
Wdr63 C T 3: 146,097,140 probably null Het
Xrcc3 T G 12: 111,805,051 D213A probably damaging Het
Zeb2 T C 2: 44,996,976 T690A probably benign Het
Zfp623 C T 15: 75,948,100 L302F probably damaging Het
Zfp799 A C 17: 32,820,759 C178G possibly damaging Het
Zfy1 T C Y: 727,634 E348G unknown Het
Zhx3 A G 2: 160,779,473 W925R possibly damaging Het
Other mutations in Zfat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Zfat APN 15 68170222 missense possibly damaging 0.92
IGL00862:Zfat APN 15 68258663 splice site probably null
IGL01021:Zfat APN 15 68170166 missense possibly damaging 0.50
IGL01152:Zfat APN 15 68110504 missense probably damaging 1.00
IGL01733:Zfat APN 15 68180730 missense probably damaging 1.00
IGL01873:Zfat APN 15 68224895 missense probably benign 0.00
IGL01990:Zfat APN 15 68224817 missense probably damaging 1.00
IGL02066:Zfat APN 15 68180829 missense probably damaging 1.00
IGL02664:Zfat APN 15 68180721 missense probably damaging 1.00
IGL02955:Zfat APN 15 68181114 missense probably damaging 0.98
IGL03201:Zfat APN 15 68165909 missense probably damaging 1.00
R0145:Zfat UTSW 15 68187099 missense possibly damaging 0.95
R0408:Zfat UTSW 15 68180292 missense probably benign 0.10
R0633:Zfat UTSW 15 68180803 missense probably damaging 1.00
R1147:Zfat UTSW 15 68212583 splice site probably benign
R1508:Zfat UTSW 15 68178751 missense probably damaging 1.00
R1513:Zfat UTSW 15 68212680 missense probably damaging 1.00
R1641:Zfat UTSW 15 68180110 missense probably benign 0.19
R1889:Zfat UTSW 15 68101539 missense probably benign 0.00
R1959:Zfat UTSW 15 68146543 missense probably benign 0.32
R2030:Zfat UTSW 15 68118934 critical splice donor site probably null
R2202:Zfat UTSW 15 68179860 missense probably benign 0.36
R2340:Zfat UTSW 15 68101541 missense probably damaging 0.99
R3440:Zfat UTSW 15 68084553 missense probably benign 0.00
R3442:Zfat UTSW 15 68084553 missense probably benign 0.00
R3442:Zfat UTSW 15 68101581 missense probably damaging 0.99
R4406:Zfat UTSW 15 68180191 missense probably benign 0.00
R4649:Zfat UTSW 15 68184476 missense probably damaging 1.00
R4710:Zfat UTSW 15 68180282 missense probably benign
R4712:Zfat UTSW 15 68110475 critical splice donor site probably null
R4745:Zfat UTSW 15 68180374 missense probably benign 0.09
R4862:Zfat UTSW 15 68180110 missense probably benign 0.02
R5015:Zfat UTSW 15 68178913 missense probably damaging 1.00
R5075:Zfat UTSW 15 68180230 missense probably benign
R5208:Zfat UTSW 15 68180721 missense probably damaging 1.00
R5277:Zfat UTSW 15 68165909 missense probably damaging 1.00
R5303:Zfat UTSW 15 68110486 missense probably damaging 1.00
R5328:Zfat UTSW 15 68179828 missense probably damaging 0.99
R5642:Zfat UTSW 15 68180916 missense probably damaging 1.00
R5659:Zfat UTSW 15 68119013 missense probably damaging 1.00
R5947:Zfat UTSW 15 68179957 missense probably benign
R6046:Zfat UTSW 15 68180777 missense probably damaging 0.99
R6315:Zfat UTSW 15 68084462 missense probably damaging 1.00
R6342:Zfat UTSW 15 68180982 missense probably damaging 1.00
R6573:Zfat UTSW 15 68165854 missense probably damaging 1.00
R6789:Zfat UTSW 15 68084386 missense probably damaging 1.00
R7028:Zfat UTSW 15 68180452 missense probably damaging 1.00
R7033:Zfat UTSW 15 68181015 missense probably damaging 1.00
R7039:Zfat UTSW 15 68180362 missense probably benign
R7065:Zfat UTSW 15 68181120 missense probably damaging 1.00
R7144:Zfat UTSW 15 68178782 missense probably benign 0.12
R7208:Zfat UTSW 15 68180007 missense probably benign 0.39
R7330:Zfat UTSW 15 68212751 missense probably benign 0.00
R7345:Zfat UTSW 15 68105043 missense probably damaging 1.00
R7378:Zfat UTSW 15 68181120 missense probably damaging 1.00
R7405:Zfat UTSW 15 68184485 missense probably damaging 1.00
R7481:Zfat UTSW 15 68178866 nonsense probably null
R7672:Zfat UTSW 15 68258686 start codon destroyed probably null 0.39
R7676:Zfat UTSW 15 68224844 missense possibly damaging 0.88
R7701:Zfat UTSW 15 68180908 nonsense probably null
R7825:Zfat UTSW 15 68179920 missense probably benign 0.01
R8152:Zfat UTSW 15 68101506 missense probably benign 0.23
R8404:Zfat UTSW 15 68105067 missense probably benign 0.00
R8405:Zfat UTSW 15 68146561 missense probably damaging 1.00
R8502:Zfat UTSW 15 68105067 missense probably benign 0.00
R8534:Zfat UTSW 15 68165847 missense probably damaging 1.00
R8708:Zfat UTSW 15 68084429 missense possibly damaging 0.95
R8887:Zfat UTSW 15 68184466 missense probably damaging 1.00
R8896:Zfat UTSW 15 68180670 missense probably damaging 1.00
R8906:Zfat UTSW 15 68084555 missense possibly damaging 0.81
R9117:Zfat UTSW 15 68187069 missense probably damaging 0.98
R9137:Zfat UTSW 15 68179945 missense probably benign 0.00
R9482:Zfat UTSW 15 68212803 missense probably damaging 1.00
Z1088:Zfat UTSW 15 68187101 missense probably benign 0.00
Z1177:Zfat UTSW 15 68179828 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTCTATCTGGGCCAGTAGACAAG -3'
(R):5'- TCGATGAGAGGACTGCATGC -3'

Sequencing Primer
(F):5'- CTATCTGGGCCAGTAGACAAGAAGAG -3'
(R):5'- GACATTATTGTTGGACCTATGTCACC -3'
Posted On 2022-03-25