Mutagenetix > Incidental Mutation

Incidental Mutation 'R9310:Espl1'

705511

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9310 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 102296850 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000064465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]

AlphaFold

P60330

Predicted Effect

probably null
Transcript: ENSMUST00000064924

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050

Predicted Effect

probably benign
Transcript: ENSMUST00000230212

Predicted Effect

probably benign
Transcript: ENSMUST00000231104

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030J22Rik	T	C	8: 116,972,120	I83V	possibly damaging	Het
Abcf1	G	A	17: 35,961,729	A288V	probably null	Het
Acer1	A	T	17: 56,955,598	V184D	probably damaging	Het
Apoh	T	C	11: 108,407,481		probably null	Het
Arid1a	T	C	4: 133,686,314	Y959C	unknown	Het
Asb3	A	T	11: 31,028,962	H84L	probably benign	Het
Atxn1	A	C	13: 45,568,018	Y134D	probably damaging	Het
BC055324	A	G	1: 163,964,520	C610R	probably damaging	Het
Btbd1	T	C	7: 81,829,237	Y52C	probably damaging	Het
Cabp2	A	G	19: 4,086,464	D170G	probably damaging	Het
Cacna1a	C	A	8: 84,536,417	A407E	probably damaging	Het
Cacna2d4	T	A	6: 119,271,953		probably null	Het
Cc2d2a	T	C	5: 43,695,146	F404S	probably damaging	Het
Cdh20	T	C	1: 104,947,336	M281T	probably damaging	Het
Cfap54	A	T	10: 92,962,315	M1694K	unknown	Het
Chd6	G	T	2: 161,039,261	T261K	probably damaging	Het
Cnksr1	T	C	4: 134,229,019	S585G	probably damaging	Het
Cntnap2	A	T	6: 46,001,347	Y312F	probably damaging	Het
Coa7	T	A	4: 108,338,313	Y146*	probably null	Het
Col28a1	T	C	6: 8,175,414	K145E	unknown	Het
Coq8b	T	A	7: 27,242,061	I221N	probably damaging	Het
Cpd	A	T	11: 76,814,781	L375*	probably null	Het
Dnah5	T	C	15: 28,448,433	F4214S	probably damaging	Het
Dock2	A	G	11: 34,294,139	F1067S	possibly damaging	Het
Dpp6	G	A	5: 27,631,441	A310T	probably damaging	Het
Dpp6	C	A	5: 27,725,644	L825I	probably benign	Het
Efcab5	A	G	11: 77,113,705	V929A	probably benign	Het
Ephx3	C	G	17: 32,189,316	D45H	probably benign	Het
Gm4847	T	C	1: 166,632,712	R402G	probably benign	Het
Grid1	T	C	14: 35,026,805	L194S	probably damaging	Het
Heatr1	A	T	13: 12,438,610	H2122L	probably benign	Het
Il17b	T	A	18: 61,692,263	C123*	probably null	Het
Il17rc	T	C	6: 113,474,249	L181P	probably damaging	Het
Inpp5e	T	A	2: 26,397,928	I619L	probably benign	Het
Itgax	C	A	7: 128,142,260	Y814*	probably null	Het
Marcks	C	T	10: 37,136,491	E183K	unknown	Het
Mefv	T	C	16: 3,715,388	T340A	probably benign	Het
Mical2	A	G	7: 112,351,713	K958R	probably benign	Het
Mkl2	T	A	16: 13,401,090	D533E	probably benign	Het
Mtor	T	A	4: 148,469,377	L811Q	probably benign	Het
Myh4	A	G	11: 67,254,744	Y1351C	probably damaging	Het
Neb	T	C	2: 52,263,696	M2406V	probably benign	Het
Nebl	T	C	2: 17,348,867	T214A	probably benign	Het
Nlrx1	A	T	9: 44,253,408	I913N	probably damaging	Het
Npr2	G	T	4: 43,632,404	A74S	probably benign	Het
Olfr1220	T	A	2: 89,097,913	S5C	probably damaging	Het
Olfr711	C	A	7: 106,971,471	C291F	probably damaging	Het
Olfr794	T	A	10: 129,570,818	N54K	probably benign	Het
Pard3b	G	T	1: 62,166,369	V441F	probably damaging	Het
Pcsk1	G	A	13: 75,090,072	R4K	probably benign	Het
Pisd	G	T	5: 32,737,440	N337K	possibly damaging	Het
Pml	T	C	9: 58,249,662	K10R	probably benign	Het
Prkci	T	C	3: 31,029,515	W132R	probably damaging	Het
Prrc2a	A	T	17: 35,155,999	M1225K	probably benign	Het
Prss23	T	C	7: 89,509,934	D309G	probably damaging	Het
Pxdn	G	A	12: 30,002,052	G743S	probably damaging	Het
Rab29	A	T	1: 131,872,122	E145V	probably damaging	Het
Rasef	C	T	4: 73,735,719		probably null	Het
Rcbtb1	T	G	14: 59,235,250	I496S	probably benign	Het
Rcor1	T	C	12: 111,099,959	Y228H		Het
Reep5	C	T	18: 34,357,169	V92I	probably damaging	Het
Rfx3	T	C	19: 27,849,929	S86G	probably benign	Het
Rptn	T	A	3: 93,397,077	D572E	probably benign	Het
Rsl1	A	T	13: 67,176,446		probably null	Het
Sbf2	T	C	7: 110,315,085	E1630G	possibly damaging	Het
Sele	G	A	1: 164,049,406	V84I	probably benign	Het
Serpina1b	T	C	12: 103,732,497	D31G	probably benign	Het
Serpina3c	T	C	12: 104,149,554	I244V	probably benign	Het
Serpinb6e	A	G	13: 33,833,221	V272A	probably benign	Het
Serpinb9b	A	G	13: 33,035,540	D150G	probably benign	Het
Sgpp1	T	C	12: 75,722,600	T265A	probably benign	Het
Slc9a1	T	A	4: 133,416,370	M389K	probably damaging	Het
Slco3a1	A	T	7: 74,554,488	C35S	probably damaging	Het
Slco6d1	T	A	1: 98,499,894	V650E	possibly damaging	Het
Slit2	T	C	5: 48,192,226	V274A	possibly damaging	Het
Snd1	A	G	6: 28,795,937	E593G	probably null	Het
Spata2l	C	T	8: 123,234,134	V139M	probably benign	Het
Suco	T	C	1: 161,856,858	K231R	probably damaging	Het
Tenm3	C	A	8: 48,555,900		probably benign	Het
Tg	T	C	15: 66,827,269	S2415P	possibly damaging	Het
Traf6	C	A	2: 101,696,727	A274D	possibly damaging	Het
Usp14	A	G	18: 9,996,239	I447T	possibly damaging	Het
Usp32	G	A	11: 85,051,202	L355F	probably benign	Het
Vcpip1	T	C	1: 9,747,702	N152S	possibly damaging	Het
Vgf	A	G	5: 137,032,256	Q424R	probably benign	Het
Vmn2r84	A	T	10: 130,392,124	M81K	possibly damaging	Het
Washc5	G	A	15: 59,346,218	A732V	possibly damaging	Het
Wdr63	C	T	3: 146,097,140		probably null	Het
Xrcc3	T	G	12: 111,805,051	D213A	probably damaging	Het
Zeb2	T	C	2: 44,996,976	T690A	probably benign	Het
Zfat	G	A	15: 68,084,401	S1212L	probably damaging	Het
Zfp623	C	T	15: 75,948,100	L302F	probably damaging	Het
Zfp799	A	C	17: 32,820,759	C178G	possibly damaging	Het
Zfy1	T	C	Y: 727,634	E348G	unknown	Het
Zhx3	A	G	2: 160,779,473	W925R	possibly damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCGCATAGGATTTCTGGTG -3'
(R):5'- ATGATCACATTAGTAGCCCTAGGG -3'

Sequencing Primer
(F):5'- CGCATAGGATTTCTGGTGGGATTC -3'
(R):5'- GGCTGGCTTCGAACTCAGAAATTC -3'

Posted On

2022-03-25