Incidental Mutation 'R9310:Espl1'
ID 705511
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 102205285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]
AlphaFold P60330
Predicted Effect probably null
Transcript: ENSMUST00000064924
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229050
Predicted Effect probably benign
Transcript: ENSMUST00000230212
Predicted Effect probably benign
Transcript: ENSMUST00000231104
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 117,698,859 (GRCm39) I83V possibly damaging Het
Abcf1 G A 17: 36,272,621 (GRCm39) A288V probably null Het
Acer1 A T 17: 57,262,598 (GRCm39) V184D probably damaging Het
Apoh T C 11: 108,298,307 (GRCm39) probably null Het
Arid1a T C 4: 133,413,625 (GRCm39) Y959C unknown Het
Asb3 A T 11: 30,978,962 (GRCm39) H84L probably benign Het
Atxn1 A C 13: 45,721,494 (GRCm39) Y134D probably damaging Het
Btbd1 T C 7: 81,478,985 (GRCm39) Y52C probably damaging Het
Cabp2 A G 19: 4,136,464 (GRCm39) D170G probably damaging Het
Cacna1a C A 8: 85,263,046 (GRCm39) A407E probably damaging Het
Cacna2d4 T A 6: 119,248,914 (GRCm39) probably null Het
Cc2d2a T C 5: 43,852,488 (GRCm39) F404S probably damaging Het
Cdh20 T C 1: 104,875,061 (GRCm39) M281T probably damaging Het
Cfap54 A T 10: 92,798,177 (GRCm39) M1694K unknown Het
Chd6 G T 2: 160,881,181 (GRCm39) T261K probably damaging Het
Cnksr1 T C 4: 133,956,330 (GRCm39) S585G probably damaging Het
Cntnap2 A T 6: 45,978,281 (GRCm39) Y312F probably damaging Het
Coa7 T A 4: 108,195,510 (GRCm39) Y146* probably null Het
Col28a1 T C 6: 8,175,414 (GRCm39) K145E unknown Het
Coq8b T A 7: 26,941,486 (GRCm39) I221N probably damaging Het
Cpd A T 11: 76,705,607 (GRCm39) L375* probably null Het
Dnah5 T C 15: 28,448,579 (GRCm39) F4214S probably damaging Het
Dnai3 C T 3: 145,802,895 (GRCm39) probably null Het
Dock2 A G 11: 34,244,139 (GRCm39) F1067S possibly damaging Het
Dpp6 G A 5: 27,836,439 (GRCm39) A310T probably damaging Het
Dpp6 C A 5: 27,930,642 (GRCm39) L825I probably benign Het
Efcab5 A G 11: 77,004,531 (GRCm39) V929A probably benign Het
Ephx3 C G 17: 32,408,290 (GRCm39) D45H probably benign Het
Firrm A G 1: 163,792,089 (GRCm39) C610R probably damaging Het
Gm4847 T C 1: 166,460,281 (GRCm39) R402G probably benign Het
Grid1 T C 14: 34,748,762 (GRCm39) L194S probably damaging Het
Heatr1 A T 13: 12,453,491 (GRCm39) H2122L probably benign Het
Il17b T A 18: 61,825,334 (GRCm39) C123* probably null Het
Il17rc T C 6: 113,451,210 (GRCm39) L181P probably damaging Het
Inpp5e T A 2: 26,287,940 (GRCm39) I619L probably benign Het
Itgax C A 7: 127,741,432 (GRCm39) Y814* probably null Het
Marcks C T 10: 37,012,487 (GRCm39) E183K unknown Het
Mefv T C 16: 3,533,252 (GRCm39) T340A probably benign Het
Mical2 A G 7: 111,950,920 (GRCm39) K958R probably benign Het
Mrtfb T A 16: 13,218,954 (GRCm39) D533E probably benign Het
Mtor T A 4: 148,553,834 (GRCm39) L811Q probably benign Het
Myh4 A G 11: 67,145,570 (GRCm39) Y1351C probably damaging Het
Neb T C 2: 52,153,708 (GRCm39) M2406V probably benign Het
Nebl T C 2: 17,353,678 (GRCm39) T214A probably benign Het
Nlrx1 A T 9: 44,164,705 (GRCm39) I913N probably damaging Het
Npr2 G T 4: 43,632,404 (GRCm39) A74S probably benign Het
Or4c115 T A 2: 88,928,257 (GRCm39) S5C probably damaging Het
Or6b6 C A 7: 106,570,678 (GRCm39) C291F probably damaging Het
Or6c88 T A 10: 129,406,687 (GRCm39) N54K probably benign Het
Pard3b G T 1: 62,205,528 (GRCm39) V441F probably damaging Het
Pcsk1 G A 13: 75,238,191 (GRCm39) R4K probably benign Het
Pisd G T 5: 32,894,784 (GRCm39) N337K possibly damaging Het
Pml T C 9: 58,156,945 (GRCm39) K10R probably benign Het
Prkci T C 3: 31,083,664 (GRCm39) W132R probably damaging Het
Prrc2a A T 17: 35,374,975 (GRCm39) M1225K probably benign Het
Prss23 T C 7: 89,159,142 (GRCm39) D309G probably damaging Het
Pxdn G A 12: 30,052,051 (GRCm39) G743S probably damaging Het
Rab29 A T 1: 131,799,860 (GRCm39) E145V probably damaging Het
Rasef C T 4: 73,653,956 (GRCm39) probably null Het
Rcbtb1 T G 14: 59,472,699 (GRCm39) I496S probably benign Het
Rcor1 T C 12: 111,066,393 (GRCm39) Y228H Het
Reep5 C T 18: 34,490,222 (GRCm39) V92I probably damaging Het
Rfx3 T C 19: 27,827,329 (GRCm39) S86G probably benign Het
Rptn T A 3: 93,304,384 (GRCm39) D572E probably benign Het
Rsl1 A T 13: 67,324,510 (GRCm39) probably null Het
Sbf2 T C 7: 109,914,292 (GRCm39) E1630G possibly damaging Het
Sele G A 1: 163,876,975 (GRCm39) V84I probably benign Het
Serpina1b T C 12: 103,698,756 (GRCm39) D31G probably benign Het
Serpina3c T C 12: 104,115,813 (GRCm39) I244V probably benign Het
Serpinb6e A G 13: 34,017,204 (GRCm39) V272A probably benign Het
Serpinb9b A G 13: 33,219,523 (GRCm39) D150G probably benign Het
Sgpp1 T C 12: 75,769,374 (GRCm39) T265A probably benign Het
Slc9a1 T A 4: 133,143,681 (GRCm39) M389K probably damaging Het
Slco3a1 A T 7: 74,204,236 (GRCm39) C35S probably damaging Het
Slco6d1 T A 1: 98,427,619 (GRCm39) V650E possibly damaging Het
Slit2 T C 5: 48,349,568 (GRCm39) V274A possibly damaging Het
Snd1 A G 6: 28,795,936 (GRCm39) E593G probably null Het
Spata2l C T 8: 123,960,873 (GRCm39) V139M probably benign Het
Suco T C 1: 161,684,427 (GRCm39) K231R probably damaging Het
Tenm3 C A 8: 49,008,935 (GRCm39) probably benign Het
Tg T C 15: 66,699,118 (GRCm39) S2415P possibly damaging Het
Traf6 C A 2: 101,527,072 (GRCm39) A274D possibly damaging Het
Usp14 A G 18: 9,996,239 (GRCm39) I447T possibly damaging Het
Usp32 G A 11: 84,942,028 (GRCm39) L355F probably benign Het
Vcpip1 T C 1: 9,817,927 (GRCm39) N152S possibly damaging Het
Vgf A G 5: 137,061,110 (GRCm39) Q424R probably benign Het
Vmn2r84 A T 10: 130,227,993 (GRCm39) M81K possibly damaging Het
Washc5 G A 15: 59,218,067 (GRCm39) A732V possibly damaging Het
Xrcc3 T G 12: 111,771,485 (GRCm39) D213A probably damaging Het
Zeb2 T C 2: 44,886,988 (GRCm39) T690A probably benign Het
Zfat G A 15: 67,956,250 (GRCm39) S1212L probably damaging Het
Zfp623 C T 15: 75,819,949 (GRCm39) L302F probably damaging Het
Zfp799 A C 17: 33,039,733 (GRCm39) C178G possibly damaging Het
Zfy1 T C Y: 727,634 (GRCm39) E348G unknown Het
Zhx3 A G 2: 160,621,393 (GRCm39) W925R possibly damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGCATAGGATTTCTGGTG -3'
(R):5'- ATGATCACATTAGTAGCCCTAGGG -3'

Sequencing Primer
(F):5'- CGCATAGGATTTCTGGTGGGATTC -3'
(R):5'- GGCTGGCTTCGAACTCAGAAATTC -3'
Posted On 2022-03-25