Incidental Mutation 'R9310:Prrc2a'
ID 705516
Institutional Source Beutler Lab
Gene Symbol Prrc2a
Ensembl Gene ENSMUSG00000024393
Gene Name proline-rich coiled-coil 2A
Synonyms D17H6S51E, G2, 3110039B05Rik, Bat-2, Bat2, Wbp12
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.882) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 35149076-35164897 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 35155999 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1225 (M1225K)
Ref Sequence ENSEMBL: ENSMUSP00000025253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025253] [ENSMUST00000174805]
AlphaFold Q7TSC1
Predicted Effect probably benign
Transcript: ENSMUST00000025253
AA Change: M1225K

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025253
Gene: ENSMUSG00000024393
AA Change: M1225K

DomainStartEndE-ValueType
Pfam:BAT2_N 1 189 1.2e-70 PFAM
low complexity region 243 276 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
low complexity region 396 413 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
coiled coil region 455 494 N/A INTRINSIC
low complexity region 504 523 N/A INTRINSIC
low complexity region 527 566 N/A INTRINSIC
low complexity region 593 618 N/A INTRINSIC
low complexity region 643 684 N/A INTRINSIC
low complexity region 687 709 N/A INTRINSIC
low complexity region 711 717 N/A INTRINSIC
low complexity region 755 768 N/A INTRINSIC
low complexity region 826 833 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
low complexity region 882 894 N/A INTRINSIC
low complexity region 902 924 N/A INTRINSIC
low complexity region 944 966 N/A INTRINSIC
low complexity region 1032 1070 N/A INTRINSIC
low complexity region 1129 1149 N/A INTRINSIC
low complexity region 1162 1179 N/A INTRINSIC
low complexity region 1190 1211 N/A INTRINSIC
low complexity region 1234 1242 N/A INTRINSIC
low complexity region 1285 1300 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1394 1424 N/A INTRINSIC
low complexity region 1430 1456 N/A INTRINSIC
low complexity region 1488 1511 N/A INTRINSIC
low complexity region 1553 1565 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
internal_repeat_1 1810 1860 5.56e-5 PROSPERO
low complexity region 1879 1895 N/A INTRINSIC
internal_repeat_1 1924 1983 5.56e-5 PROSPERO
low complexity region 1995 2017 N/A INTRINSIC
low complexity region 2019 2041 N/A INTRINSIC
low complexity region 2070 2086 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174805
AA Change: M1170K
SMART Domains Protein: ENSMUSP00000133550
Gene: ENSMUSG00000024393
AA Change: M1170K

DomainStartEndE-ValueType
Pfam:BAT2_N 1 137 6.6e-53 PFAM
low complexity region 188 221 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
coiled coil region 400 439 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 472 511 N/A INTRINSIC
low complexity region 538 563 N/A INTRINSIC
low complexity region 588 629 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 656 662 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
low complexity region 771 778 N/A INTRINSIC
low complexity region 806 816 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 847 869 N/A INTRINSIC
low complexity region 889 911 N/A INTRINSIC
low complexity region 977 1015 N/A INTRINSIC
low complexity region 1074 1094 N/A INTRINSIC
low complexity region 1107 1124 N/A INTRINSIC
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1179 1187 N/A INTRINSIC
low complexity region 1230 1245 N/A INTRINSIC
low complexity region 1291 1305 N/A INTRINSIC
low complexity region 1339 1369 N/A INTRINSIC
low complexity region 1375 1401 N/A INTRINSIC
low complexity region 1433 1456 N/A INTRINSIC
low complexity region 1498 1510 N/A INTRINSIC
low complexity region 1638 1658 N/A INTRINSIC
internal_repeat_1 1755 1804 3.99e-5 PROSPERO
low complexity region 1823 1839 N/A INTRINSIC
internal_repeat_1 1868 1927 3.99e-5 PROSPERO
low complexity region 1939 1961 N/A INTRINSIC
low complexity region 1963 1985 N/A INTRINSIC
low complexity region 2014 2030 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for TNF alpha and TNF beta. These genes are all within the human major histocompatibility complex class III region. This gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. This gene is also a candidate gene for the development of rheumatoid arthritis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 116,972,120 I83V possibly damaging Het
Abcf1 G A 17: 35,961,729 A288V probably null Het
Acer1 A T 17: 56,955,598 V184D probably damaging Het
Apoh T C 11: 108,407,481 probably null Het
Arid1a T C 4: 133,686,314 Y959C unknown Het
Asb3 A T 11: 31,028,962 H84L probably benign Het
Atxn1 A C 13: 45,568,018 Y134D probably damaging Het
BC055324 A G 1: 163,964,520 C610R probably damaging Het
Btbd1 T C 7: 81,829,237 Y52C probably damaging Het
Cabp2 A G 19: 4,086,464 D170G probably damaging Het
Cacna1a C A 8: 84,536,417 A407E probably damaging Het
Cacna2d4 T A 6: 119,271,953 probably null Het
Cc2d2a T C 5: 43,695,146 F404S probably damaging Het
Cdh20 T C 1: 104,947,336 M281T probably damaging Het
Cfap54 A T 10: 92,962,315 M1694K unknown Het
Chd6 G T 2: 161,039,261 T261K probably damaging Het
Cnksr1 T C 4: 134,229,019 S585G probably damaging Het
Cntnap2 A T 6: 46,001,347 Y312F probably damaging Het
Coa7 T A 4: 108,338,313 Y146* probably null Het
Col28a1 T C 6: 8,175,414 K145E unknown Het
Coq8b T A 7: 27,242,061 I221N probably damaging Het
Cpd A T 11: 76,814,781 L375* probably null Het
Dnah5 T C 15: 28,448,433 F4214S probably damaging Het
Dock2 A G 11: 34,294,139 F1067S possibly damaging Het
Dpp6 G A 5: 27,631,441 A310T probably damaging Het
Dpp6 C A 5: 27,725,644 L825I probably benign Het
Efcab5 A G 11: 77,113,705 V929A probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Espl1 G A 15: 102,296,850 probably null Het
Gm4847 T C 1: 166,632,712 R402G probably benign Het
Grid1 T C 14: 35,026,805 L194S probably damaging Het
Heatr1 A T 13: 12,438,610 H2122L probably benign Het
Il17b T A 18: 61,692,263 C123* probably null Het
Il17rc T C 6: 113,474,249 L181P probably damaging Het
Inpp5e T A 2: 26,397,928 I619L probably benign Het
Itgax C A 7: 128,142,260 Y814* probably null Het
Marcks C T 10: 37,136,491 E183K unknown Het
Mefv T C 16: 3,715,388 T340A probably benign Het
Mical2 A G 7: 112,351,713 K958R probably benign Het
Mkl2 T A 16: 13,401,090 D533E probably benign Het
Mtor T A 4: 148,469,377 L811Q probably benign Het
Myh4 A G 11: 67,254,744 Y1351C probably damaging Het
Neb T C 2: 52,263,696 M2406V probably benign Het
Nebl T C 2: 17,348,867 T214A probably benign Het
Nlrx1 A T 9: 44,253,408 I913N probably damaging Het
Npr2 G T 4: 43,632,404 A74S probably benign Het
Olfr1220 T A 2: 89,097,913 S5C probably damaging Het
Olfr711 C A 7: 106,971,471 C291F probably damaging Het
Olfr794 T A 10: 129,570,818 N54K probably benign Het
Pard3b G T 1: 62,166,369 V441F probably damaging Het
Pcsk1 G A 13: 75,090,072 R4K probably benign Het
Pisd G T 5: 32,737,440 N337K possibly damaging Het
Pml T C 9: 58,249,662 K10R probably benign Het
Prkci T C 3: 31,029,515 W132R probably damaging Het
Prss23 T C 7: 89,509,934 D309G probably damaging Het
Pxdn G A 12: 30,002,052 G743S probably damaging Het
Rab29 A T 1: 131,872,122 E145V probably damaging Het
Rasef C T 4: 73,735,719 probably null Het
Rcbtb1 T G 14: 59,235,250 I496S probably benign Het
Rcor1 T C 12: 111,099,959 Y228H Het
Reep5 C T 18: 34,357,169 V92I probably damaging Het
Rfx3 T C 19: 27,849,929 S86G probably benign Het
Rptn T A 3: 93,397,077 D572E probably benign Het
Rsl1 A T 13: 67,176,446 probably null Het
Sbf2 T C 7: 110,315,085 E1630G possibly damaging Het
Sele G A 1: 164,049,406 V84I probably benign Het
Serpina1b T C 12: 103,732,497 D31G probably benign Het
Serpina3c T C 12: 104,149,554 I244V probably benign Het
Serpinb6e A G 13: 33,833,221 V272A probably benign Het
Serpinb9b A G 13: 33,035,540 D150G probably benign Het
Sgpp1 T C 12: 75,722,600 T265A probably benign Het
Slc9a1 T A 4: 133,416,370 M389K probably damaging Het
Slco3a1 A T 7: 74,554,488 C35S probably damaging Het
Slco6d1 T A 1: 98,499,894 V650E possibly damaging Het
Slit2 T C 5: 48,192,226 V274A possibly damaging Het
Snd1 A G 6: 28,795,937 E593G probably null Het
Spata2l C T 8: 123,234,134 V139M probably benign Het
Suco T C 1: 161,856,858 K231R probably damaging Het
Tenm3 C A 8: 48,555,900 probably benign Het
Tg T C 15: 66,827,269 S2415P possibly damaging Het
Traf6 C A 2: 101,696,727 A274D possibly damaging Het
Usp14 A G 18: 9,996,239 I447T possibly damaging Het
Usp32 G A 11: 85,051,202 L355F probably benign Het
Vcpip1 T C 1: 9,747,702 N152S possibly damaging Het
Vgf A G 5: 137,032,256 Q424R probably benign Het
Vmn2r84 A T 10: 130,392,124 M81K possibly damaging Het
Washc5 G A 15: 59,346,218 A732V possibly damaging Het
Wdr63 C T 3: 146,097,140 probably null Het
Xrcc3 T G 12: 111,805,051 D213A probably damaging Het
Zeb2 T C 2: 44,996,976 T690A probably benign Het
Zfat G A 15: 68,084,401 S1212L probably damaging Het
Zfp623 C T 15: 75,948,100 L302F probably damaging Het
Zfp799 A C 17: 32,820,759 C178G possibly damaging Het
Zfy1 T C Y: 727,634 E348G unknown Het
Zhx3 A G 2: 160,779,473 W925R possibly damaging Het
Other mutations in Prrc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Prrc2a APN 17 35154983 missense probably damaging 0.99
IGL01083:Prrc2a APN 17 35156201 missense possibly damaging 0.93
IGL01394:Prrc2a APN 17 35153104 missense probably benign 0.00
IGL01618:Prrc2a APN 17 35149553 missense probably damaging 1.00
IGL01700:Prrc2a APN 17 35150667 missense possibly damaging 0.93
IGL01937:Prrc2a APN 17 35155591 missense possibly damaging 0.63
IGL02407:Prrc2a APN 17 35160504 missense unknown
IGL02683:Prrc2a APN 17 35155993 missense probably benign 0.00
R0145:Prrc2a UTSW 17 35155820 missense probably benign
R0309:Prrc2a UTSW 17 35150915 splice site probably benign
R0441:Prrc2a UTSW 17 35149688 splice site probably benign
R0617:Prrc2a UTSW 17 35153560 missense probably damaging 1.00
R0645:Prrc2a UTSW 17 35156332 missense probably damaging 0.99
R1351:Prrc2a UTSW 17 35157887 missense possibly damaging 0.86
R1432:Prrc2a UTSW 17 35153912 splice site probably benign
R1490:Prrc2a UTSW 17 35153254 missense probably benign
R1643:Prrc2a UTSW 17 35156954 missense probably damaging 0.99
R1734:Prrc2a UTSW 17 35150707 missense possibly damaging 0.93
R1869:Prrc2a UTSW 17 35153308 missense possibly damaging 0.93
R1937:Prrc2a UTSW 17 35157908 missense probably damaging 0.99
R1995:Prrc2a UTSW 17 35157429 missense probably damaging 0.98
R2257:Prrc2a UTSW 17 35161068 missense unknown
R2270:Prrc2a UTSW 17 35149536 missense possibly damaging 0.91
R3940:Prrc2a UTSW 17 35157498 missense possibly damaging 0.86
R3973:Prrc2a UTSW 17 35157932 missense probably damaging 0.99
R4569:Prrc2a UTSW 17 35158497 missense unknown
R4655:Prrc2a UTSW 17 35155614 missense probably benign 0.00
R4792:Prrc2a UTSW 17 35156487 missense probably damaging 0.96
R4797:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R4798:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R4799:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R5004:Prrc2a UTSW 17 35149998 missense probably benign 0.11
R5129:Prrc2a UTSW 17 35160178 missense unknown
R5155:Prrc2a UTSW 17 35160091 splice site probably null
R5210:Prrc2a UTSW 17 35153620 missense probably damaging 0.99
R5308:Prrc2a UTSW 17 35161047 missense unknown
R5474:Prrc2a UTSW 17 35159213 missense unknown
R5775:Prrc2a UTSW 17 35158487 missense unknown
R5934:Prrc2a UTSW 17 35150084 missense probably damaging 0.98
R6057:Prrc2a UTSW 17 35152740 missense probably benign 0.00
R6291:Prrc2a UTSW 17 35154933 missense probably damaging 0.99
R6535:Prrc2a UTSW 17 35162265 missense unknown
R6622:Prrc2a UTSW 17 35155420 missense probably damaging 0.98
R6887:Prrc2a UTSW 17 35155675 missense probably damaging 0.99
R6971:Prrc2a UTSW 17 35159501 splice site probably null
R7026:Prrc2a UTSW 17 35161827 missense unknown
R7059:Prrc2a UTSW 17 35157388 missense probably damaging 0.99
R7489:Prrc2a UTSW 17 35162354 missense unknown
R7502:Prrc2a UTSW 17 35162310 missense unknown
R7951:Prrc2a UTSW 17 35160501 missense unknown
R8061:Prrc2a UTSW 17 35161186 splice site probably benign
R8324:Prrc2a UTSW 17 35156984 missense possibly damaging 0.46
R8705:Prrc2a UTSW 17 35153566 missense possibly damaging 0.92
R9016:Prrc2a UTSW 17 35159868 missense unknown
R9376:Prrc2a UTSW 17 35150622 missense possibly damaging 0.85
X0011:Prrc2a UTSW 17 35155898 missense probably damaging 0.99
Z1177:Prrc2a UTSW 17 35154815 missense probably damaging 0.98
Z1177:Prrc2a UTSW 17 35155700 missense probably damaging 0.99
Z1177:Prrc2a UTSW 17 35161360 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGAGACTTAGCAGCTGTGC -3'
(R):5'- CAAGAGGAGTACCATCACGC -3'

Sequencing Primer
(F):5'- TAGTGTCTCCTCAGGTCCAGG -3'
(R):5'- AGTACCATCACGCCGTGG -3'
Posted On 2022-03-25