Incidental Mutation 'R9311:Myh7b'
ID 705534
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Name myosin, heavy chain 7B, cardiac muscle, beta
Synonyms Myh14
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9311 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 155611212-155634307 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155621333 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 495 (H495R)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
AlphaFold A2AQP0
Predicted Effect probably damaging
Transcript: ENSMUST00000092995
AA Change: H495R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: H495R

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310046K23Rik T G 3: 92,533,090 Q14P unknown Het
5430419D17Rik A T 7: 131,257,761 D1137V unknown Het
A4gnt T C 9: 99,613,763 I84T possibly damaging Het
Adad2 G T 8: 119,615,247 R268L probably damaging Het
Agxt2 A T 15: 10,380,647 N208I probably damaging Het
Brsk1 G T 7: 4,706,723 probably null Het
Cd40 A T 2: 165,070,747 Q235L possibly damaging Het
Cln6 T C 9: 62,850,618 Y220H probably damaging Het
Cngb1 A T 8: 95,284,166 probably null Het
Cpne1 A T 2: 156,077,803 V277E probably damaging Het
Csf2rb2 C T 15: 78,292,535 probably null Het
Cyp4f15 A G 17: 32,686,165 T41A probably benign Het
Dab1 T C 4: 104,512,266 probably null Het
Eif4e1b C A 13: 54,784,519 H56N probably benign Het
Elp3 A T 14: 65,586,339 D78E probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Gabarap T A 11: 69,991,723 V4E probably benign Het
Gm5105 T A 3: 138,049,657 D56V unknown Het
Gosr2 G T 11: 103,683,867 H134Q probably damaging Het
Ifi204 A G 1: 173,761,649 V72A possibly damaging Het
Irx1 A G 13: 71,959,297 V422A probably benign Het
Kcne4 C A 1: 78,818,107 D157E probably benign Het
Kctd13 A G 7: 126,942,173 N195S probably damaging Het
Kirrel A G 3: 87,097,816 V75A probably benign Het
Klkb1 T C 8: 45,269,946 T625A probably benign Het
Lama5 A G 2: 180,196,482 probably null Het
Lifr A G 15: 7,178,937 I599V possibly damaging Het
Lin52 A T 12: 84,529,696 E101V probably damaging Het
Liph C T 16: 21,956,163 R428Q probably damaging Het
Liph T C 16: 21,983,930 I130V probably benign Het
Lrrc4c A C 2: 97,630,735 I569L possibly damaging Het
Mnat1 G A 12: 73,168,142 V78I probably benign Het
Msln C T 17: 25,753,016 D76N probably benign Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Nfu1 T C 6: 87,009,944 V15A probably benign Het
Nphp4 T C 4: 152,524,257 S441P probably damaging Het
Nuak1 T C 10: 84,378,226 probably null Het
Olfr153 A G 2: 87,532,014 probably benign Het
Olfr197 A T 16: 59,185,743 C247S unknown Het
Olfr352 A T 2: 36,870,393 I276F probably damaging Het
Olfr918 A G 9: 38,672,629 S272P probably damaging Het
Palld A G 8: 61,525,155 V1109A unknown Het
Pik3c3 G A 18: 30,312,613 R551H probably benign Het
Plcb1 G A 2: 135,347,465 V838I probably benign Het
Plppr4 G T 3: 117,325,869 T297K probably damaging Het
Ptprd A G 4: 76,133,083 I67T probably benign Het
Rb1cc1 T A 1: 6,240,315 N312K probably damaging Het
Sh3glb1 A C 3: 144,691,898 probably null Het
Siglec1 C T 2: 131,074,093 C1283Y probably damaging Het
Spns1 T C 7: 126,373,823 I204V probably damaging Het
Supt6 T C 11: 78,225,458 Y693C probably damaging Het
Taar9 A G 10: 24,109,254 V94A probably damaging Het
Tchp T C 5: 114,708,816 S55P probably benign Het
Tmem132b A G 5: 125,785,965 H678R possibly damaging Het
Tnr G C 1: 159,850,093 G16A probably benign Het
Top3b T C 16: 16,882,699 probably null Het
Tpmt A G 13: 47,032,416 probably null Het
Treh G A 9: 44,681,358 V87I probably benign Het
Ttc4 T C 4: 106,678,766 D33G probably benign Het
Usp47 A G 7: 112,104,050 D1171G probably benign Het
Vmn2r61 G T 7: 42,300,668 L837F possibly damaging Het
Vmn2r86 T A 10: 130,452,571 N354Y probably damaging Het
Zscan4b C A 7: 10,902,023 V126F probably damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
Irrational UTSW 2 155630672 unclassified probably benign
Muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
R7652:Myh7b UTSW 2 155632236 missense probably damaging 0.99
R7678:Myh7b UTSW 2 155617778 splice site probably null
R7703:Myh7b UTSW 2 155620436 missense probably null 1.00
R7711:Myh7b UTSW 2 155620403 missense probably damaging 1.00
R7923:Myh7b UTSW 2 155625966 missense probably benign
R7967:Myh7b UTSW 2 155614199 splice site probably null
R8045:Myh7b UTSW 2 155613181 missense probably benign 0.00
R8176:Myh7b UTSW 2 155625966 missense probably benign 0.06
R8272:Myh7b UTSW 2 155632904 missense probably damaging 1.00
R8560:Myh7b UTSW 2 155623204 missense possibly damaging 0.93
R8706:Myh7b UTSW 2 155611749 critical splice donor site probably null
R8824:Myh7b UTSW 2 155630381 missense probably benign 0.02
R8832:Myh7b UTSW 2 155633262 missense probably benign 0.00
R9079:Myh7b UTSW 2 155623254 missense probably damaging 0.97
R9151:Myh7b UTSW 2 155632519 missense probably damaging 1.00
R9332:Myh7b UTSW 2 155628802 missense probably damaging 1.00
R9357:Myh7b UTSW 2 155621348 missense probably damaging 1.00
R9388:Myh7b UTSW 2 155631063 missense probably benign 0.28
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGACATCGCTGGTTTTG -3'
(R):5'- ATTGATAGGCAGCTTATCCAGG -3'

Sequencing Primer
(F):5'- AGATTTTTGAGGTGAGAAGAGCTC -3'
(R):5'- AGCTTATCCAGGCCTGCAC -3'
Posted On 2022-03-25