Mutagenetix > Incidental Mutation

Incidental Mutation 'R9311:Kirrel1'

705538

Institutional Source

Beutler Lab

Gene Symbol

Kirrel1

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

6720469N11Rik, Neph1, Kirrel1, Kirrel

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9311 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86985900-87082054 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87005123 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 75 (V75A)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

probably benign
Transcript: ENSMUST00000041732
AA Change: V75A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: V75A

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107618
AA Change: V75A

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: V75A

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159976
AA Change: V75A

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: V75A

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4gnt	T	C	9: 99,495,816 (GRCm39)	I84T	possibly damaging	Het
Adad2	G	T	8: 120,341,986 (GRCm39)	R268L	probably damaging	Het
Agxt2	A	T	15: 10,380,733 (GRCm39)	N208I	probably damaging	Het
Brsk1	G	T	7: 4,709,722 (GRCm39)		probably null	Het
Cd40	A	T	2: 164,912,667 (GRCm39)	Q235L	possibly damaging	Het
Cdcp3	A	T	7: 130,859,490 (GRCm39)	D1137V	unknown	Het
Cln6	T	C	9: 62,757,900 (GRCm39)	Y220H	probably damaging	Het
Cngb1	A	T	8: 96,010,794 (GRCm39)		probably null	Het
Cpne1	A	T	2: 155,919,723 (GRCm39)	V277E	probably damaging	Het
Csf2rb2	C	T	15: 78,176,735 (GRCm39)		probably null	Het
Cyp4f15	A	G	17: 32,905,139 (GRCm39)	T41A	probably benign	Het
Dab1	T	C	4: 104,369,463 (GRCm39)		probably null	Het
Eif4e1b	C	A	13: 54,932,332 (GRCm39)	H56N	probably benign	Het
Elp3	A	T	14: 65,823,788 (GRCm39)	D78E	probably benign	Het
Ephx3	C	G	17: 32,408,290 (GRCm39)	D45H	probably benign	Het
Gabarap	T	A	11: 69,882,549 (GRCm39)	V4E	probably benign	Het
Gm5105	T	A	3: 137,755,418 (GRCm39)	D56V	unknown	Het
Gosr2	G	T	11: 103,574,693 (GRCm39)	H134Q	probably damaging	Het
Ifi204	A	G	1: 173,589,215 (GRCm39)	V72A	possibly damaging	Het
Irx1	A	G	13: 72,107,416 (GRCm39)	V422A	probably benign	Het
Kcne4	C	A	1: 78,795,824 (GRCm39)	D157E	probably benign	Het
Kctd13	A	G	7: 126,541,345 (GRCm39)	N195S	probably damaging	Het
Klkb1	T	C	8: 45,722,983 (GRCm39)	T625A	probably benign	Het
Lama5	A	G	2: 179,838,275 (GRCm39)		probably null	Het
Lifr	A	G	15: 7,208,418 (GRCm39)	I599V	possibly damaging	Het
Lin52	A	T	12: 84,576,470 (GRCm39)	E101V	probably damaging	Het
Liph	T	C	16: 21,802,680 (GRCm39)	I130V	probably benign	Het
Liph	C	T	16: 21,774,913 (GRCm39)	R428Q	probably damaging	Het
Lrrc4c	A	C	2: 97,461,080 (GRCm39)	I569L	possibly damaging	Het
Mnat1	G	A	12: 73,214,916 (GRCm39)	V78I	probably benign	Het
Msln	C	T	17: 25,971,990 (GRCm39)	D76N	probably benign	Het
Myh7b	A	G	2: 155,463,253 (GRCm39)	H495R	probably damaging	Het
Ndst4	C	T	3: 125,518,385 (GRCm39)	S354L	probably benign	Het
Nfu1	T	C	6: 86,986,926 (GRCm39)	V15A	probably benign	Het
Nphp4	T	C	4: 152,608,714 (GRCm39)	S441P	probably damaging	Het
Nuak1	T	C	10: 84,214,090 (GRCm39)		probably null	Het
Or1j20	A	T	2: 36,760,405 (GRCm39)	I276F	probably damaging	Het
Or5h27	A	T	16: 59,006,106 (GRCm39)	C247S	unknown	Het
Or5w22	A	G	2: 87,362,358 (GRCm39)		probably benign	Het
Or8b3b	A	G	9: 38,583,925 (GRCm39)	S272P	probably damaging	Het
Palld	A	G	8: 61,978,189 (GRCm39)	V1109A	unknown	Het
Pik3c3	G	A	18: 30,445,666 (GRCm39)	R551H	probably benign	Het
Plcb1	G	A	2: 135,189,385 (GRCm39)	V838I	probably benign	Het
Plppr4	G	T	3: 117,119,518 (GRCm39)	T297K	probably damaging	Het
Ptprd	A	G	4: 76,051,320 (GRCm39)	I67T	probably benign	Het
Rb1cc1	T	A	1: 6,310,539 (GRCm39)	N312K	probably damaging	Het
Sh3glb1	A	C	3: 144,397,659 (GRCm39)		probably null	Het
Siglec1	C	T	2: 130,916,013 (GRCm39)	C1283Y	probably damaging	Het
Spns1	T	C	7: 125,972,995 (GRCm39)	I204V	probably damaging	Het
Sprr5	T	G	3: 92,440,397 (GRCm39)	Q14P	unknown	Het
Supt6	T	C	11: 78,116,284 (GRCm39)	Y693C	probably damaging	Het
Taar9	A	G	10: 23,985,152 (GRCm39)	V94A	probably damaging	Het
Tchp	T	C	5: 114,846,877 (GRCm39)	S55P	probably benign	Het
Tmem132b	A	G	5: 125,863,029 (GRCm39)	H678R	possibly damaging	Het
Tnr	G	C	1: 159,677,663 (GRCm39)	G16A	probably benign	Het
Top3b	T	C	16: 16,700,563 (GRCm39)		probably null	Het
Tpmt	A	G	13: 47,185,892 (GRCm39)		probably null	Het
Treh	G	A	9: 44,592,655 (GRCm39)	V87I	probably benign	Het
Ttc4	T	C	4: 106,535,963 (GRCm39)	D33G	probably benign	Het
Usp47	A	G	7: 111,703,257 (GRCm39)	D1171G	probably benign	Het
Vmn2r61	G	T	7: 41,950,092 (GRCm39)	L837F	possibly damaging	Het
Vmn2r86	T	A	10: 130,288,440 (GRCm39)	N354Y	probably damaging	Het
Vmn2r88	C	G	14: 51,650,503 (GRCm39)	A72G	probably benign	Het
Zscan4b	C	A	7: 10,635,950 (GRCm39)	V126F	probably damaging	Het

Other mutations in Kirrel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel1	APN	3	86,997,182 (GRCm39)	missense	probably benign	0.22
IGL01865:Kirrel1	APN	3	86,993,731 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kirrel1	APN	3	87,003,037 (GRCm39)	missense	probably damaging	1.00
IGL02337:Kirrel1	APN	3	86,996,519 (GRCm39)	missense	possibly damaging	0.64
IGL02724:Kirrel1	APN	3	86,997,780 (GRCm39)	nonsense	probably null
IGL02825:Kirrel1	APN	3	86,996,595 (GRCm39)	splice site	probably benign
IGL02826:Kirrel1	APN	3	86,995,792 (GRCm39)	missense	probably damaging	1.00
IGL03102:Kirrel1	APN	3	86,990,807 (GRCm39)	missense	probably damaging	0.98
D4043:Kirrel1	UTSW	3	86,990,510 (GRCm39)	missense	probably benign	0.02
R0360:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0364:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0421:Kirrel1	UTSW	3	86,990,914 (GRCm39)	missense	probably damaging	0.99
R0503:Kirrel1	UTSW	3	87,005,109 (GRCm39)	missense	probably benign	0.20
R1112:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1116:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1144:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1190:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1226:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1501:Kirrel1	UTSW	3	86,997,779 (GRCm39)	missense	probably benign	0.02
R1538:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1546:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1628:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1630:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1631:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1664:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1671:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1695:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1769:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1807:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1808:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1840:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1995:Kirrel1	UTSW	3	87,003,093 (GRCm39)	missense	possibly damaging	0.88
R2014:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2086:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2108:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2354:Kirrel1	UTSW	3	86,995,792 (GRCm39)	missense	probably damaging	0.98
R2407:Kirrel1	UTSW	3	86,992,150 (GRCm39)	missense	probably benign	0.03
R2904:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2905:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2958:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2959:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2960:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2961:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3026:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3028:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3034:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R3149:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3195:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3196:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3499:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3699:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3720:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3721:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3788:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3793:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3877:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3901:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3910:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3911:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3912:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3913:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3930:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3931:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4022:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4067:Kirrel1	UTSW	3	86,995,774 (GRCm39)	nonsense	probably null
R4077:Kirrel1	UTSW	3	86,992,387 (GRCm39)	critical splice donor site	probably null
R4198:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4328:Kirrel1	UTSW	3	86,992,081 (GRCm39)	intron	probably benign
R4355:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4363:Kirrel1	UTSW	3	86,997,792 (GRCm39)	nonsense	probably null
R4378:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4386:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4460:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4468:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4469:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4650:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4652:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4734:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4748:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4749:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R5304:Kirrel1	UTSW	3	86,996,902 (GRCm39)	missense	probably benign	0.02
R5534:Kirrel1	UTSW	3	86,997,825 (GRCm39)	missense	probably damaging	1.00
R5604:Kirrel1	UTSW	3	86,996,462 (GRCm39)	missense	possibly damaging	0.69
R7199:Kirrel1	UTSW	3	86,990,695 (GRCm39)	missense	probably benign	0.02
R7221:Kirrel1	UTSW	3	86,993,704 (GRCm39)	nonsense	probably null
R7284:Kirrel1	UTSW	3	86,990,694 (GRCm39)	missense	probably benign	0.02
R7332:Kirrel1	UTSW	3	86,995,705 (GRCm39)	missense	probably benign	0.14
R7369:Kirrel1	UTSW	3	87,048,391 (GRCm39)	missense	probably benign	0.20
R7371:Kirrel1	UTSW	3	86,995,729 (GRCm39)	missense	probably benign	0.44
R7508:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R7566:Kirrel1	UTSW	3	86,995,791 (GRCm39)	missense	probably damaging	1.00
R7567:Kirrel1	UTSW	3	87,002,988 (GRCm39)	missense	probably damaging	0.99
R7621:Kirrel1	UTSW	3	86,995,528 (GRCm39)	missense	possibly damaging	0.70
R8030:Kirrel1	UTSW	3	87,005,082 (GRCm39)	missense	probably damaging	1.00
R8141:Kirrel1	UTSW	3	86,993,735 (GRCm39)	nonsense	probably null
R8261:Kirrel1	UTSW	3	86,995,309 (GRCm39)	intron	probably benign
R8477:Kirrel1	UTSW	3	86,992,138 (GRCm39)	missense	possibly damaging	0.71
R8512:Kirrel1	UTSW	3	86,995,534 (GRCm39)	missense	probably benign	0.00
R8954:Kirrel1	UTSW	3	86,997,173 (GRCm39)	missense	probably benign	0.25
R8987:Kirrel1	UTSW	3	86,992,400 (GRCm39)	missense	probably damaging	1.00
R9058:Kirrel1	UTSW	3	86,992,442 (GRCm39)	missense	probably benign	0.18
R9146:Kirrel1	UTSW	3	87,003,015 (GRCm39)	missense	probably damaging	1.00
R9527:Kirrel1	UTSW	3	86,996,912 (GRCm39)	nonsense	probably null
R9629:Kirrel1	UTSW	3	87,003,025 (GRCm39)	nonsense	probably null
Z1177:Kirrel1	UTSW	3	86,991,182 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAAGCCAGGAATCTAGGCTG -3'
(R):5'- GCCCTGAGCCAGAGATTATG -3'

Sequencing Primer
(F):5'- CCAGGAATCTAGGCTGAGAGC -3'
(R):5'- TTATGAAGTAAAGGAATTACGTGGC -3'

Posted On

2022-03-25