Incidental Mutation 'R0738:Spopl'
ID70557
Institutional Source Beutler Lab
Gene Symbol Spopl
Ensembl Gene ENSMUSG00000026771
Gene Namespeckle-type POZ protein-like
SynonymsE430033K04Rik, 4921517N04Rik
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location23506220-23572106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23537521 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 200 (T200A)
Ref Sequence ENSEMBL: ENSMUSP00000114974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028110] [ENSMUST00000132484] [ENSMUST00000132827]
Predicted Effect probably benign
Transcript: ENSMUST00000028110
SMART Domains Protein: ENSMUSP00000141519
Gene: ENSMUSG00000026771

DomainStartEndE-ValueType
MATH 2 108 5.9e-17 SMART
low complexity region 141 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132484
AA Change: T200A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114974
Gene: ENSMUSG00000026771
AA Change: T200A

DomainStartEndE-ValueType
MATH 36 142 9.46e-15 SMART
BTB 200 297 5.99e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132827
SMART Domains Protein: ENSMUSP00000142047
Gene: ENSMUSG00000026771

DomainStartEndE-ValueType
MATH 36 142 5.9e-17 SMART
low complexity region 175 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136290
Meta Mutation Damage Score 0.1167 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with no gross morphological and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Spopl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Spopl APN 2 23537631 missense possibly damaging 0.88
P4748:Spopl UTSW 2 23511443 missense probably benign 0.01
PIT4453001:Spopl UTSW 2 23545449 missense probably damaging 0.99
R2358:Spopl UTSW 2 23537380 missense probably damaging 1.00
R3711:Spopl UTSW 2 23537380 missense probably damaging 1.00
R3712:Spopl UTSW 2 23537380 missense probably damaging 1.00
R4097:Spopl UTSW 2 23511401 missense probably benign 0.01
R4400:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4421:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4497:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4498:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4570:Spopl UTSW 2 23537485 nonsense probably null
R4702:Spopl UTSW 2 23515297 splice site probably null
R6919:Spopl UTSW 2 23517861 missense probably benign 0.06
R7387:Spopl UTSW 2 23537509 missense probably benign
R7921:Spopl UTSW 2 23545478 missense probably benign
X0067:Spopl UTSW 2 23544867 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GAGGACACATTTCCCCAGTTTCTAAAGT -3'
(R):5'- gccatttctctacctccAGGTTTCCA -3'

Sequencing Primer
(F):5'- GCCTTTTAACAACATTTACCTTTGTG -3'
(R):5'- GTGTCACCACTGAACAAGATTTAC -3'
Posted On2013-09-30