Incidental Mutation 'R0738:Wdr5'
ID70558
Institutional Source Beutler Lab
Gene Symbol Wdr5
Ensembl Gene ENSMUSG00000026917
Gene NameWD repeat domain 5
SynonymsBmp2-induced gene, 2410008O07Rik, Big-3
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location27515157-27536535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27519412 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 49 (S49P)
Ref Sequence ENSEMBL: ENSMUSP00000109585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113952]
PDB Structure
WDR5 IN COMPLEX WITH AN RBBP5 PEPTIDE RECRUITED TO NOVEL SITE [X-RAY DIFFRACTION]
WDR5 IN COMPLEX WITH AN RBBP5 PEPTIDE AND HISTONE H3 PEPTIDE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000113952
AA Change: S49P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109585
Gene: ENSMUSG00000026917
AA Change: S49P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
WD40 34 73 4.11e-10 SMART
WD40 76 115 1.69e-11 SMART
WD40 118 157 9.22e-13 SMART
WD40 160 199 1.84e-12 SMART
WD40 202 242 7.33e-7 SMART
WD40 245 287 1.17e-5 SMART
WD40 290 331 3.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140396
SMART Domains Protein: ENSMUSP00000121654
Gene: ENSMUSG00000026917

DomainStartEndE-ValueType
WD40 7 46 1.69e-11 SMART
WD40 49 88 9.22e-13 SMART
WD40 91 130 1.84e-12 SMART
WD40 133 189 1.33e-4 SMART
WD40 192 234 1.17e-5 SMART
WD40 237 278 3.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144315
Meta Mutation Damage Score 0.8285 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 7 WD repeats. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Wdr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Wdr5 APN 2 27520867 missense probably benign 0.00
IGL01478:Wdr5 APN 2 27533832 missense probably damaging 1.00
IGL02690:Wdr5 APN 2 27534828 missense probably benign 0.08
IGL02742:Wdr5 APN 2 27520425 splice site probably benign
IGL03059:Wdr5 APN 2 27519734 unclassified probably benign
R0241:Wdr5 UTSW 2 27533013 missense probably damaging 1.00
R0630:Wdr5 UTSW 2 27520607 missense probably benign 0.05
R1329:Wdr5 UTSW 2 27531671 missense probably damaging 1.00
R4130:Wdr5 UTSW 2 27520429 splice site probably benign
R5488:Wdr5 UTSW 2 27525153 missense probably damaging 1.00
R5859:Wdr5 UTSW 2 27533350 missense probably damaging 1.00
R5879:Wdr5 UTSW 2 27528311 missense probably benign 0.01
R6775:Wdr5 UTSW 2 27533374 missense probably damaging 1.00
R7583:Wdr5 UTSW 2 27518775 missense probably benign 0.00
R7849:Wdr5 UTSW 2 27519451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTCAAGAGAGGTGCTAGGCTC -3'
(R):5'- TGCTGAATGCTAACCAACCCAGAG -3'

Sequencing Primer
(F):5'- CTCACACTGGCAGTTTAAAGG -3'
(R):5'- GAGACCAGTAACAACTAACACAGTC -3'
Posted On2013-09-30