Mutagenetix > Incidental Mutations

Incidental Mutation 'R0738:Rc3h2'

70559

Institutional Source

Beutler Lab

Gene Symbol

Rc3h2

Ensembl Gene

ENSMUSG00000075376

Gene Name

ring finger and CCCH-type zinc finger domains 2

Synonyms

Mnab, D930043C02Rik, Rnf164, 2900024N03Rik, 9430019J22Rik

MMRRC Submission

038919-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0738 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37370069-37422903 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37405374 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 210 (D210V)

Ref Sequence

ENSEMBL: ENSMUSP00000145082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100143] [ENSMUST00000112934] [ENSMUST00000112936] [ENSMUST00000125619]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100143
AA Change: D210V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000097721
Gene: ENSMUSG00000075376
AA Change: D210V

Domain	Start	End	E-Value	Type
RING	14	53	2.87e-5	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	1.58e-3	SMART
low complexity region	609	633	N/A	INTRINSIC
low complexity region	668	688	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112934
AA Change: D210V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108556
Gene: ENSMUSG00000075376
AA Change: D210V

Domain	Start	End	E-Value	Type
RING	14	53	2.87e-5	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	1.58e-3	SMART
low complexity region	609	633	N/A	INTRINSIC
low complexity region	668	688	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112936
AA Change: D210V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108558
Gene: ENSMUSG00000075376
AA Change: D210V

Domain	Start	End	E-Value	Type
RING	14	53	2.87e-5	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	1.58e-3	SMART
low complexity region	609	633	N/A	INTRINSIC
low complexity region	668	688	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124218

Predicted Effect

probably damaging
Transcript: ENSMUST00000125619
AA Change: D210V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145082
Gene: ENSMUSG00000075376
AA Change: D210V

Domain	Start	End	E-Value	Type
RING	14	53	1.4e-7	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	6.9e-6	SMART
low complexity region	455	466	N/A	INTRINSIC

Meta Mutation Damage Score

0.7657

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.6%
20x: 92.3%

Validation Efficiency

98% (46/47)

MGI Phenotype

PHENOTYPE: Homozygotes for a knock-out allele are viable and healthy but show increased TNF production by macrophages in response to LPS. Homozygotes for a different knock-out allele show postnatal lethality, decreased body size and weight, and an immature lung phenotype with decreased alveolar expansion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930011G23Rik	A	T	5: 99,240,953	M189K	probably benign	Het
Ank1	A	T	8: 23,114,114	E964D	probably damaging	Het
Ankhd1	A	G	18: 36,645,249		probably benign	Het
Cd9	G	T	6: 125,462,140	Q169K	probably benign	Het
Cdc42bpa	T	A	1: 179,999,462		probably benign	Het
Ch25h	T	C	19: 34,474,387	N247S	possibly damaging	Het
Dctn1	T	C	6: 83,190,107		probably null	Het
Defa22	C	T	8: 21,162,375	T19I	probably benign	Het
Dscam	T	C	16: 96,819,781	N576D	possibly damaging	Het
Epha3	T	C	16: 63,595,612	M675V	probably damaging	Het
Fam241a	C	A	3: 127,870,793	A120S	possibly damaging	Het
Fkbp8	T	A	8: 70,529,670	I86N	probably damaging	Het
Herc4	C	T	10: 63,289,149	P514L	possibly damaging	Het
Ide	A	T	19: 37,277,965	L813*	probably null	Het
Igkv12-41	G	A	6: 69,858,691	Q26*	probably null	Het
Itsn2	T	C	12: 4,635,681	V483A	probably benign	Het
Kcp	A	T	6: 29,490,439	I1002N	probably benign	Het
Lrfn5	G	T	12: 61,840,592	E389*	probably null	Het
Lrp6	G	T	6: 134,542,045	A19E	probably benign	Het
Mad1l1	A	G	5: 140,300,560	L228P	probably damaging	Het
Map2	T	C	1: 66,425,189		probably benign	Het
Med13l	T	A	5: 118,751,633	Y1820N	probably damaging	Het
Mgam	A	G	6: 40,754,935	N735S	probably benign	Het
Mid2	A	G	X: 140,763,676	Y618C	probably damaging	Het
Mllt11	G	A	3: 95,220,286	Q58*	probably null	Het
Mttp	A	G	3: 138,103,313	V678A	probably damaging	Het
Nfatc1	A	G	18: 80,697,910	S278P	probably damaging	Het
Ninj2	A	G	6: 120,198,137		probably benign	Het
Nsd3	T	A	8: 25,678,709		probably null	Het
Olfr1454	A	T	19: 13,063,738	E109V	probably damaging	Het
Olfr895	T	C	9: 38,269,125	V204A	possibly damaging	Het
Pcdhb4	A	G	18: 37,308,711	N358S	probably damaging	Het
Plch1	T	C	3: 63,702,553		probably benign	Het
Popdc3	T	C	10: 45,315,258	L155P	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm26	A	T	14: 105,176,782	I24N	unknown	Het
Samd1	CGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	8: 83,998,996		probably benign	Het
Spopl	T	C	2: 23,537,521	T200A	probably benign	Het
Tarbp1	A	G	8: 126,438,801		probably null	Het
Thnsl1	T	A	2: 21,213,362	H121Q	probably damaging	Het
Tll1	T	C	8: 64,101,950	D233G	probably damaging	Het
Vmn2r27	A	T	6: 124,223,702	V432E	possibly damaging	Het
Wdr5	T	C	2: 27,519,412	S49P	probably damaging	Het
Zfyve26	A	T	12: 79,295,534	I46N	probably damaging	Het

Other mutations in Rc3h2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Rc3h2	APN	2	37389747	missense	possibly damaging	0.59
IGL00944:Rc3h2	APN	2	37398238	splice site	probably benign
IGL01065:Rc3h2	APN	2	37377844	splice site	probably benign
IGL01966:Rc3h2	APN	2	37382777	splice site	probably benign
IGL02123:Rc3h2	APN	2	37398253	missense	probably damaging	1.00
IGL02174:Rc3h2	APN	2	37411225	missense	probably benign	0.11
IGL02448:Rc3h2	APN	2	37389805	missense	probably benign	0.08
IGL02539:Rc3h2	APN	2	37389715	missense	probably benign	0.09
IGL02698:Rc3h2	APN	2	37405300	missense	probably damaging	0.99
IGL02731:Rc3h2	APN	2	37382811	missense	probably benign	0.00
IGL02958:Rc3h2	APN	2	37414700	missense	probably damaging	1.00
IGL02959:Rc3h2	APN	2	37405354	missense	probably damaging	1.00
PIT4468001:Rc3h2	UTSW	2	37399639	missense	probably damaging	1.00
R0309:Rc3h2	UTSW	2	37379008	splice site	probably benign
R0488:Rc3h2	UTSW	2	37389588	missense	probably damaging	0.99
R0506:Rc3h2	UTSW	2	37376659	critical splice donor site	probably null
R0612:Rc3h2	UTSW	2	37411215	missense	possibly damaging	0.77
R0628:Rc3h2	UTSW	2	37382052	splice site	probably benign
R0647:Rc3h2	UTSW	2	37409530	missense	probably damaging	1.00
R0680:Rc3h2	UTSW	2	37399835	missense	probably damaging	0.97
R2005:Rc3h2	UTSW	2	37389753	nonsense	probably null
R2105:Rc3h2	UTSW	2	37399624	missense	possibly damaging	0.89
R2133:Rc3h2	UTSW	2	37378916	missense	probably benign	0.12
R2373:Rc3h2	UTSW	2	37379001	missense	possibly damaging	0.94
R2414:Rc3h2	UTSW	2	37399819	critical splice donor site	probably null
R2850:Rc3h2	UTSW	2	37377415	missense	probably benign
R2913:Rc3h2	UTSW	2	37378959	missense	possibly damaging	0.89
R2932:Rc3h2	UTSW	2	37378359	missense	probably benign	0.10
R4441:Rc3h2	UTSW	2	37414514	critical splice donor site	probably null
R4932:Rc3h2	UTSW	2	37389832	missense	possibly damaging	0.77
R5114:Rc3h2	UTSW	2	37398361	splice site	probably null
R5169:Rc3h2	UTSW	2	37405312	missense	probably damaging	1.00
R5360:Rc3h2	UTSW	2	37389855	missense	possibly damaging	0.59
R5477:Rc3h2	UTSW	2	37399630	missense	possibly damaging	0.94
R5553:Rc3h2	UTSW	2	37398311	nonsense	probably null
R5776:Rc3h2	UTSW	2	37378313	missense	possibly damaging	0.59
R5842:Rc3h2	UTSW	2	37378371	missense	possibly damaging	0.77
R5935:Rc3h2	UTSW	2	37414733	frame shift	probably null
R6060:Rc3h2	UTSW	2	37399600	missense	possibly damaging	0.77
R6112:Rc3h2	UTSW	2	37378887	missense	possibly damaging	0.59
R6172:Rc3h2	UTSW	2	37414733	frame shift	probably null
R6173:Rc3h2	UTSW	2	37414733	frame shift	probably null
R6177:Rc3h2	UTSW	2	37389646	missense	probably benign	0.02
R6455:Rc3h2	UTSW	2	37409470	missense	probably damaging	1.00
R6457:Rc3h2	UTSW	2	37411139	critical splice donor site	probably null
R6467:Rc3h2	UTSW	2	37382016	missense	probably damaging	0.97
R6647:Rc3h2	UTSW	2	37382944	nonsense	probably null
R6694:Rc3h2	UTSW	2	37400543	missense	probably damaging	1.00
R6695:Rc3h2	UTSW	2	37414661	missense	possibly damaging	0.88
R7054:Rc3h2	UTSW	2	37375246	missense	probably benign	0.07
R7159:Rc3h2	UTSW	2	37409647	missense	probably benign	0.39
R7162:Rc3h2	UTSW	2	37409605	missense	possibly damaging	0.59
R7640:Rc3h2	UTSW	2	37377849	critical splice donor site	probably null
R7676:Rc3h2	UTSW	2	37405332	missense	possibly damaging	0.95
R8209:Rc3h2	UTSW	2	37376989	missense	possibly damaging	0.77
R8226:Rc3h2	UTSW	2	37376989	missense	possibly damaging	0.77
R8324:Rc3h2	UTSW	2	37400726	missense	possibly damaging	0.77
R8528:Rc3h2	UTSW	2	37382799	missense	probably benign	0.05
X0013:Rc3h2	UTSW	2	37389786	missense	possibly damaging	0.60

Predicted Primers

PCR Primer
(F):5'- ATTTCTGAGGGTCACTAGATTGGCAAC -3'
(R):5'- CCTGGGTTCTGGGGATTAAACTCAAG -3'

Sequencing Primer
(F):5'- TCTCAGAAGCCTCCATCTCAGG -3'
(R):5'- ctggggattaaactcaagattgc -3'

Posted On

2013-09-30