Incidental Mutation 'R0738:Mllt11'
ID70561
Institutional Source Beutler Lab
Gene Symbol Mllt11
Ensembl Gene ENSMUSG00000053192
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 11
SynonymsAf1q
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95219135-95232171 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 95220286 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 58 (Q58*)
Ref Sequence ENSEMBL: ENSMUSP00000142604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065482] [ENSMUST00000107204] [ENSMUST00000107209] [ENSMUST00000136139] [ENSMUST00000196025] [ENSMUST00000198948]
Predicted Effect probably null
Transcript: ENSMUST00000065482
AA Change: Q58*
SMART Domains Protein: ENSMUSP00000066448
Gene: ENSMUSG00000053192
AA Change: Q58*

DomainStartEndE-ValueType
Pfam:AF1Q 1 65 2.6e-11 PFAM
internal_repeat_1 68 79 4.85e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070774
Predicted Effect probably benign
Transcript: ENSMUST00000107204
SMART Domains Protein: ENSMUSP00000102822
Gene: ENSMUSG00000038766

DomainStartEndE-ValueType
Blast:ANK 5 34 5e-11 BLAST
ANK 37 66 3.41e-3 SMART
ANK 70 99 1.18e-6 SMART
ANK 103 132 3.76e-5 SMART
ANK 136 166 1.48e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107209
SMART Domains Protein: ENSMUSP00000102827
Gene: ENSMUSG00000038766

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-10 BLAST
ANK 37 66 3.41e-3 SMART
ANK 70 99 1.18e-6 SMART
ANK 103 132 3.76e-5 SMART
ANK 136 165 1.1e2 SMART
low complexity region 280 292 N/A INTRINSIC
coiled coil region 310 362 N/A INTRINSIC
low complexity region 363 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136139
SMART Domains Protein: ENSMUSP00000121283
Gene: ENSMUSG00000038766

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-10 BLAST
ANK 37 66 3.41e-3 SMART
ANK 70 99 1.18e-6 SMART
ANK 103 132 3.76e-5 SMART
ANK 136 165 1.1e2 SMART
low complexity region 280 292 N/A INTRINSIC
coiled coil region 310 362 N/A INTRINSIC
low complexity region 363 389 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181819
Predicted Effect probably null
Transcript: ENSMUST00000196025
AA Change: Q58*
SMART Domains Protein: ENSMUSP00000143755
Gene: ENSMUSG00000053192
AA Change: Q58*

DomainStartEndE-ValueType
Pfam:AF1Q 1 65 2.6e-11 PFAM
internal_repeat_1 68 79 4.85e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000198948
AA Change: Q58*
SMART Domains Protein: ENSMUSP00000142604
Gene: ENSMUSG00000053192
AA Change: Q58*

DomainStartEndE-ValueType
Pfam:AF1Q 1 65 2.6e-11 PFAM
internal_repeat_1 68 79 4.85e-5 PROSPERO
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene variously symbolized ALL1, HRX, or MLL located on 11q23 has been demonstrated to be fused with a number of translocation partners in cases of leukemia. t(1;11)(q21;q23) translocations that fused the MLL gene to a gene on chromosomal band 1q21 in 2 infants with acute myelomonocytic leukemia have been demonstrated. The N-terminal portion of the MLL gene is critical for leukemogenesis in translocations involving band 11q23. This gene encodes 90 amino acids. It was found to be highly expressed in the thymus but not in peripheral lymphoid tissues. In contrast to its restricted distribution in normal hematopoietic tissue, this gene was expressed in all leukemic cell lines tested. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Mllt11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5708:Mllt11 UTSW 3 95220204 missense probably benign 0.00
R6237:Mllt11 UTSW 3 95220291 missense probably benign 0.04
R7034:Mllt11 UTSW 3 95220433 missense probably damaging 1.00
R7827:Mllt11 UTSW 3 95220237 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGATTCATCAGCACCACCAG -3'
(R):5'- AGGAGCTTGCTCTATCGTGGAGAC -3'

Sequencing Primer
(F):5'- CCACCAGCACAATAGAGGGAAG -3'
(R):5'- TGCTCTATCGTGGAGACTAACAC -3'
Posted On2013-09-30