Mutagenetix > Incidental Mutations

Incidental Mutation 'R0738:Mttp'

70563

Institutional Source

Beutler Lab

Gene Symbol

Mttp

Ensembl Gene

ENSMUSG00000028158

Gene Name

microsomal triglyceride transfer protein

Synonyms

1810043K16Rik, MTP

MMRRC Submission

038919-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.797) question?

Stock #

R0738 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

138089854-138144968 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 138103313 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 678 (V678A)

Ref Sequence

ENSEMBL: ENSMUSP00000096179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029805] [ENSMUST00000098580]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029805
AA Change: V663A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029805
Gene: ENSMUSG00000028158
AA Change: V663A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
LPD_N	28	579	8.87e-165	SMART
Blast:LPD_N	582	695	4e-58	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000098580
AA Change: V678A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096179
Gene: ENSMUSG00000028158
AA Change: V678A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
LPD_N	43	594	8.87e-165	SMART
Blast:LPD_N	597	710	6e-58	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196625

Meta Mutation Damage Score

0.4144

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.6%
20x: 92.3%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a reporter allele die at midgestation displaying delayed growth, neurodevelopmental anomalies, impaired erythropoiesis, deficient yolk sac lipoprotein production, hemorrhage and necrosis. Heterozygous mutant mice display altered plasma lipid and lipoprotein profiles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930011G23Rik	A	T	5: 99,240,953	M189K	probably benign	Het
Ank1	A	T	8: 23,114,114	E964D	probably damaging	Het
Ankhd1	A	G	18: 36,645,249		probably benign	Het
Cd9	G	T	6: 125,462,140	Q169K	probably benign	Het
Cdc42bpa	T	A	1: 179,999,462		probably benign	Het
Ch25h	T	C	19: 34,474,387	N247S	possibly damaging	Het
Dctn1	T	C	6: 83,190,107		probably null	Het
Defa22	C	T	8: 21,162,375	T19I	probably benign	Het
Dscam	T	C	16: 96,819,781	N576D	possibly damaging	Het
Epha3	T	C	16: 63,595,612	M675V	probably damaging	Het
Fam241a	C	A	3: 127,870,793	A120S	possibly damaging	Het
Fkbp8	T	A	8: 70,529,670	I86N	probably damaging	Het
Herc4	C	T	10: 63,289,149	P514L	possibly damaging	Het
Ide	A	T	19: 37,277,965	L813*	probably null	Het
Igkv12-41	G	A	6: 69,858,691	Q26*	probably null	Het
Itsn2	T	C	12: 4,635,681	V483A	probably benign	Het
Kcp	A	T	6: 29,490,439	I1002N	probably benign	Het
Lrfn5	G	T	12: 61,840,592	E389*	probably null	Het
Lrp6	G	T	6: 134,542,045	A19E	probably benign	Het
Mad1l1	A	G	5: 140,300,560	L228P	probably damaging	Het
Map2	T	C	1: 66,425,189		probably benign	Het
Med13l	T	A	5: 118,751,633	Y1820N	probably damaging	Het
Mgam	A	G	6: 40,754,935	N735S	probably benign	Het
Mid2	A	G	X: 140,763,676	Y618C	probably damaging	Het
Mllt11	G	A	3: 95,220,286	Q58*	probably null	Het
Nfatc1	A	G	18: 80,697,910	S278P	probably damaging	Het
Ninj2	A	G	6: 120,198,137		probably benign	Het
Nsd3	T	A	8: 25,678,709		probably null	Het
Olfr1454	A	T	19: 13,063,738	E109V	probably damaging	Het
Olfr895	T	C	9: 38,269,125	V204A	possibly damaging	Het
Pcdhb4	A	G	18: 37,308,711	N358S	probably damaging	Het
Plch1	T	C	3: 63,702,553		probably benign	Het
Popdc3	T	C	10: 45,315,258	L155P	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm26	A	T	14: 105,176,782	I24N	unknown	Het
Rc3h2	T	A	2: 37,405,374	D210V	probably damaging	Het
Samd1	CGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	8: 83,998,996		probably benign	Het
Spopl	T	C	2: 23,537,521	T200A	probably benign	Het
Tarbp1	A	G	8: 126,438,801		probably null	Het
Thnsl1	T	A	2: 21,213,362	H121Q	probably damaging	Het
Tll1	T	C	8: 64,101,950	D233G	probably damaging	Het
Vmn2r27	A	T	6: 124,223,702	V432E	possibly damaging	Het
Wdr5	T	C	2: 27,519,412	S49P	probably damaging	Het
Zfyve26	A	T	12: 79,295,534	I46N	probably damaging	Het

Other mutations in Mttp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00722:Mttp	APN	3	138109015	missense	possibly damaging	0.84
IGL00983:Mttp	APN	3	138115129	splice site	probably benign
IGL01128:Mttp	APN	3	138133997	splice site	probably null
IGL01607:Mttp	APN	3	138104698	missense	probably damaging	0.99
IGL01760:Mttp	APN	3	138111736	missense	probably benign	0.00
IGL01947:Mttp	APN	3	138107129	missense	probably damaging	1.00
IGL02184:Mttp	APN	3	138116000	critical splice donor site	probably null
IGL02932:Mttp	APN	3	138111744	missense	probably benign	0.07
IGL02957:Mttp	APN	3	138109081	missense	possibly damaging	0.95
IGL03082:Mttp	APN	3	138123795	missense	probably benign	0.01
IGL03302:Mttp	APN	3	138104707	missense	possibly damaging	0.90
IGL03381:Mttp	APN	3	138104943	missense	probably damaging	1.00
P0040:Mttp	UTSW	3	138112566	missense	possibly damaging	0.82
R0543:Mttp	UTSW	3	138111696	missense	possibly damaging	0.75
R0967:Mttp	UTSW	3	138092723	missense	probably benign	0.00
R1281:Mttp	UTSW	3	138107219	missense	possibly damaging	0.95
R1565:Mttp	UTSW	3	138116405	critical splice donor site	probably null
R1660:Mttp	UTSW	3	138103193	missense	probably damaging	1.00
R1828:Mttp	UTSW	3	138107280	missense	probably damaging	1.00
R1886:Mttp	UTSW	3	138092615	missense	probably damaging	1.00
R1912:Mttp	UTSW	3	138116027	missense	probably benign	0.01
R1938:Mttp	UTSW	3	138125121	missense	probably benign	0.21
R2020:Mttp	UTSW	3	138118402	missense	probably damaging	0.98
R2109:Mttp	UTSW	3	138095002	missense	probably benign	0.27
R2336:Mttp	UTSW	3	138116095	missense	possibly damaging	0.81
R2392:Mttp	UTSW	3	138095021	missense	probably damaging	0.98
R3021:Mttp	UTSW	3	138111703	missense	probably benign
R3774:Mttp	UTSW	3	138114263	splice site	probably null
R3776:Mttp	UTSW	3	138114263	splice site	probably null
R4687:Mttp	UTSW	3	138092735	missense	possibly damaging	0.66
R4708:Mttp	UTSW	3	138134098	unclassified	probably benign
R4756:Mttp	UTSW	3	138116071	missense	possibly damaging	0.77
R4832:Mttp	UTSW	3	138116050	missense	probably benign
R5377:Mttp	UTSW	3	138105029	missense	probably benign	0.03
R5670:Mttp	UTSW	3	138125113	missense	probably damaging	0.99
R6613:Mttp	UTSW	3	138109078	missense	probably damaging	1.00
R6725:Mttp	UTSW	3	138107238	missense	probably damaging	1.00
R6799:Mttp	UTSW	3	138095080	missense	probably benign	0.04
R6920:Mttp	UTSW	3	138115282	missense	possibly damaging	0.49
R7074:Mttp	UTSW	3	138107273	missense	possibly damaging	0.53
R7131:Mttp	UTSW	3	138116132	missense	probably benign	0.13
R7275:Mttp	UTSW	3	138123785	missense	probably benign	0.19
R7291:Mttp	UTSW	3	138091203	missense	probably damaging	1.00
R7310:Mttp	UTSW	3	138095022	missense	probably damaging	1.00
R7769:Mttp	UTSW	3	138103112	missense	probably damaging	1.00
R7909:Mttp	UTSW	3	138118417	nonsense	probably null
R8037:Mttp	UTSW	3	138091122	missense	probably damaging	1.00
R8220:Mttp	UTSW	3	138123848	missense	probably benign	0.00
R8335:Mttp	UTSW	3	138103212	missense	possibly damaging	0.90
R8352:Mttp	UTSW	3	138112613	missense	probably damaging	1.00
R8452:Mttp	UTSW	3	138112613	missense	probably damaging	1.00
R8536:Mttp	UTSW	3	138104943	missense	probably damaging	1.00
Z1176:Mttp	UTSW	3	138104779	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAAGCCCTTTCACCACGCTGAC -3'
(R):5'- TGGGGAAAGTAACTGAGCACCACC -3'

Sequencing Primer
(F):5'- ACCACGCTGACAGGGTC -3'
(R):5'- caaggactcaaagccccac -3'

Posted On

2013-09-30