Incidental Mutation 'R0738:A930011G23Rik'
ID70564
Institutional Source Beutler Lab
Gene Symbol A930011G23Rik
Ensembl Gene ENSMUSG00000089809
Gene NameRIKEN cDNA A930011G23 gene
Synonyms
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location99297244-99729065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99240953 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 189 (M189K)
Ref Sequence ENSEMBL: ENSMUSP00000147997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031276] [ENSMUST00000166484] [ENSMUST00000168092] [ENSMUST00000209346]
Predicted Effect probably benign
Transcript: ENSMUST00000031276
AA Change: M103K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031276
Gene: ENSMUSG00000089809
AA Change: M103K

DomainStartEndE-ValueType
RasGEFN 33 157 5.22e-4 SMART
RasGEF 201 454 3.26e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166484
AA Change: M62K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128947
Gene: ENSMUSG00000089809
AA Change: M62K

DomainStartEndE-ValueType
Blast:RasGEFN 33 123 6e-50 BLAST
RasGEF 159 412 3.26e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168092
AA Change: M103K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129652
Gene: ENSMUSG00000089809
AA Change: M103K

DomainStartEndE-ValueType
RasGEFN 33 157 2.8e-4 SMART
RasGEF 200 453 3.26e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209346
AA Change: M189K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0814 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in A930011G23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:A930011G23Rik APN 5 99243243 splice site probably null
IGL00536:A930011G23Rik APN 5 99222383 missense probably damaging 1.00
IGL00848:A930011G23Rik APN 5 99222378 missense probably damaging 1.00
IGL01400:A930011G23Rik APN 5 99243101 missense probably damaging 1.00
IGL02421:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02421:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02422:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02422:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02423:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02423:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02424:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02424:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02427:A930011G23Rik APN 5 99233970 missense probably damaging 1.00
IGL02437:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02437:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02473:A930011G23Rik APN 5 99222995 missense probably damaging 1.00
IGL02498:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02498:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02499:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02499:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02537:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02537:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02609:A930011G23Rik APN 5 99233995 splice site probably benign
IGL02735:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02735:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02975:A930011G23Rik APN 5 99233925 missense possibly damaging 0.81
IGL03129:A930011G23Rik APN 5 99229379 missense probably damaging 0.98
IGL03139:A930011G23Rik APN 5 99243208 missense probably benign 0.00
IGL03239:A930011G23Rik APN 5 99233976 missense probably damaging 1.00
IGL03295:A930011G23Rik APN 5 99243056 splice site probably benign
R0011:A930011G23Rik UTSW 5 99232354 missense probably damaging 1.00
R0840:A930011G23Rik UTSW 5 99234688 missense probably benign 0.00
R1779:A930011G23Rik UTSW 5 99223038 splice site probably benign
R1799:A930011G23Rik UTSW 5 99234576 missense probably benign 0.01
R1992:A930011G23Rik UTSW 5 99233925 missense possibly damaging 0.81
R2054:A930011G23Rik UTSW 5 99228055 missense probably benign 0.01
R2157:A930011G23Rik UTSW 5 99232097 missense probably damaging 0.99
R2184:A930011G23Rik UTSW 5 99232369 missense possibly damaging 0.69
R4565:A930011G23Rik UTSW 5 99227947 intron probably benign
R4930:A930011G23Rik UTSW 5 99222404 missense possibly damaging 0.81
R5065:A930011G23Rik UTSW 5 99234573 missense probably benign 0.18
R5739:A930011G23Rik UTSW 5 99221430 missense probably damaging 1.00
R5806:A930011G23Rik UTSW 5 99240872 missense probably benign 0.05
R8228:A930011G23Rik UTSW 5 99377121 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGGCTTTCGGTGACCAACCTC -3'
(R):5'- CAGTGATAGCCTGCTTATCTCCTGC -3'

Sequencing Primer
(F):5'- AACCTCCTCGCCACTGG -3'
(R):5'- CTAGGACCGTGGGTTATATTCC -3'
Posted On2013-09-30