Incidental Mutation 'R0738:Med13l'
ID70565
Institutional Source Beutler Lab
Gene Symbol Med13l
Ensembl Gene ENSMUSG00000018076
Gene Namemediator complex subunit 13-like
Synonyms9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location118560679-118765438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118751633 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1820 (Y1820N)
Ref Sequence ENSEMBL: ENSMUSP00000144092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]
Predicted Effect probably damaging
Transcript: ENSMUST00000100816
AA Change: Y1820N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: Y1820N

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 2.5e-116 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2197 1e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201010
AA Change: Y1820N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: Y1820N

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 1e-112 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2206 1.7e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202787
Meta Mutation Damage Score 0.3266 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Med13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Med13l APN 5 118724071 missense probably damaging 0.99
IGL01012:Med13l APN 5 118734028 missense probably damaging 0.99
IGL01316:Med13l APN 5 118762781 missense probably damaging 1.00
IGL01529:Med13l APN 5 118742335 missense probably damaging 1.00
IGL01731:Med13l APN 5 118742407 missense probably benign 0.05
IGL01790:Med13l APN 5 118593522 missense probably damaging 1.00
IGL02394:Med13l APN 5 118748833 missense probably benign 0.37
IGL02432:Med13l APN 5 118738400 missense possibly damaging 0.90
IGL02698:Med13l APN 5 118762829 missense probably damaging 0.99
IGL02801:Med13l APN 5 118745113 missense probably damaging 1.00
IGL03242:Med13l APN 5 118747445 missense probably benign
IGL03270:Med13l APN 5 118731430 missense probably damaging 1.00
Basics UTSW 5 118759264 critical splice donor site probably null
Fundament UTSW 5 118721474 missense probably damaging 1.00
Root UTSW 5 118593445 missense probably damaging 1.00
P0035:Med13l UTSW 5 118742620 missense probably benign 0.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0136:Med13l UTSW 5 118724050 missense probably benign 0.15
R0158:Med13l UTSW 5 118742449 missense unknown
R0197:Med13l UTSW 5 118671002 splice site probably benign
R0370:Med13l UTSW 5 118741826 missense probably benign 0.14
R0492:Med13l UTSW 5 118738495 missense probably damaging 1.00
R0532:Med13l UTSW 5 118759123 missense possibly damaging 0.78
R0726:Med13l UTSW 5 118748684 missense probably damaging 0.99
R0827:Med13l UTSW 5 118726247 splice site probably benign
R0883:Med13l UTSW 5 118671002 splice site probably benign
R0959:Med13l UTSW 5 118754285 missense possibly damaging 0.89
R1458:Med13l UTSW 5 118738459 missense probably benign 0.00
R1562:Med13l UTSW 5 118738519 missense probably damaging 1.00
R1577:Med13l UTSW 5 118721392 missense probably damaging 1.00
R1661:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1665:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1720:Med13l UTSW 5 118741995 missense probably damaging 1.00
R1929:Med13l UTSW 5 118728833 missense probably benign 0.01
R1967:Med13l UTSW 5 118761322 missense probably damaging 0.99
R2301:Med13l UTSW 5 118593447 missense probably damaging 1.00
R3691:Med13l UTSW 5 118721497 missense probably benign 0.16
R3895:Med13l UTSW 5 118761323 missense probably null 0.99
R4043:Med13l UTSW 5 118593463 missense probably damaging 1.00
R4593:Med13l UTSW 5 118742560 missense probably damaging 1.00
R4902:Med13l UTSW 5 118745130 missense probably damaging 1.00
R4995:Med13l UTSW 5 118730949 missense possibly damaging 0.90
R5010:Med13l UTSW 5 118593550 missense possibly damaging 0.95
R5057:Med13l UTSW 5 118718493 missense probably damaging 1.00
R5369:Med13l UTSW 5 118724010 missense probably benign 0.02
R5446:Med13l UTSW 5 118742397 missense possibly damaging 0.81
R5564:Med13l UTSW 5 118742040 missense probably damaging 1.00
R5566:Med13l UTSW 5 118728665 missense possibly damaging 0.95
R5580:Med13l UTSW 5 118751630 missense possibly damaging 0.95
R5634:Med13l UTSW 5 118560850 missense possibly damaging 0.88
R5748:Med13l UTSW 5 118593445 missense probably damaging 1.00
R5764:Med13l UTSW 5 118728642 missense probably damaging 0.99
R5765:Med13l UTSW 5 118728642 missense probably damaging 0.99
R6083:Med13l UTSW 5 118721486 missense possibly damaging 0.80
R6504:Med13l UTSW 5 118754321 missense probably benign 0.34
R6546:Med13l UTSW 5 118721474 missense probably damaging 1.00
R6797:Med13l UTSW 5 118759264 critical splice donor site probably null
R6911:Med13l UTSW 5 118755658 missense possibly damaging 0.95
R6942:Med13l UTSW 5 118745006 splice site probably null
R7018:Med13l UTSW 5 118751986 missense probably damaging 0.99
R7096:Med13l UTSW 5 118721926 missense possibly damaging 0.90
R7113:Med13l UTSW 5 118726265 missense probably benign 0.09
R7136:Med13l UTSW 5 118721522 missense possibly damaging 0.90
R7140:Med13l UTSW 5 118741972 missense probably benign 0.27
R7345:Med13l UTSW 5 118742760 missense probably damaging 1.00
R7409:Med13l UTSW 5 118754321 missense probably benign 0.34
R7410:Med13l UTSW 5 118560832 missense possibly damaging 0.94
R7432:Med13l UTSW 5 118751938 missense probably damaging 0.99
R7486:Med13l UTSW 5 118728474 missense probably benign 0.17
R7509:Med13l UTSW 5 118748930 missense probably damaging 0.97
R7722:Med13l UTSW 5 118747407 missense probably benign 0.32
R7802:Med13l UTSW 5 118728590 missense probably benign 0.03
R8081:Med13l UTSW 5 118728268 missense probably damaging 1.00
R8260:Med13l UTSW 5 118748729 missense possibly damaging 0.95
R8266:Med13l UTSW 5 118742109 missense probably damaging 1.00
R8347:Med13l UTSW 5 118742597 missense probably benign
R8365:Med13l UTSW 5 118728644 missense possibly damaging 0.81
R8508:Med13l UTSW 5 118754321 missense probably benign 0.34
X0065:Med13l UTSW 5 118729883 missense probably damaging 1.00
Z1088:Med13l UTSW 5 118749641 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTAAGTCATGCCTACCAGTCCC -3'
(R):5'- GCGCAGAGTTAACAGAAGCTGACC -3'

Sequencing Primer
(F):5'- ATAGGCCCCCATAGTTCATGC -3'
(R):5'- GTTAACAGAAGCTGACCCAATTAG -3'
Posted On2013-09-30