Mutagenetix > Incidental Mutations

Incidental Mutation 'R0738:Med13l'

70565

Institutional Source

Beutler Lab

Gene Symbol

Med13l

Ensembl Gene

ENSMUSG00000018076

Gene Name

mediator complex subunit 13-like

Synonyms

9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L

MMRRC Submission

038919-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R0738 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118560679-118765438 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118751633 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1820 (Y1820N)

Ref Sequence

ENSEMBL: ENSMUSP00000144092 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100816
AA Change: Y1820N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: Y1820N

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	380	2.5e-116	PFAM
low complexity region	442	460	N/A	INTRINSIC
low complexity region	542	558	N/A	INTRINSIC
low complexity region	1020	1031	N/A	INTRINSIC
low complexity region	1044	1060	N/A	INTRINSIC
low complexity region	1541	1593	N/A	INTRINSIC
low complexity region	1601	1611	N/A	INTRINSIC
Pfam:Med13_C	1675	2197	1e-142	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201010
AA Change: Y1820N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: Y1820N

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	380	1e-112	PFAM
low complexity region	442	460	N/A	INTRINSIC
low complexity region	542	558	N/A	INTRINSIC
low complexity region	1020	1031	N/A	INTRINSIC
low complexity region	1044	1060	N/A	INTRINSIC
low complexity region	1541	1593	N/A	INTRINSIC
low complexity region	1601	1611	N/A	INTRINSIC
Pfam:Med13_C	1675	2206	1.7e-138	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202538

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202787

Meta Mutation Damage Score

0.3266

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.6%
20x: 92.3%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930011G23Rik	A	T	5: 99,240,953	M189K	probably benign	Het
Ank1	A	T	8: 23,114,114	E964D	probably damaging	Het
Ankhd1	A	G	18: 36,645,249		probably benign	Het
Cd9	G	T	6: 125,462,140	Q169K	probably benign	Het
Cdc42bpa	T	A	1: 179,999,462		probably benign	Het
Ch25h	T	C	19: 34,474,387	N247S	possibly damaging	Het
Dctn1	T	C	6: 83,190,107		probably null	Het
Defa22	C	T	8: 21,162,375	T19I	probably benign	Het
Dscam	T	C	16: 96,819,781	N576D	possibly damaging	Het
Epha3	T	C	16: 63,595,612	M675V	probably damaging	Het
Fam241a	C	A	3: 127,870,793	A120S	possibly damaging	Het
Fkbp8	T	A	8: 70,529,670	I86N	probably damaging	Het
Herc4	C	T	10: 63,289,149	P514L	possibly damaging	Het
Ide	A	T	19: 37,277,965	L813*	probably null	Het
Igkv12-41	G	A	6: 69,858,691	Q26*	probably null	Het
Itsn2	T	C	12: 4,635,681	V483A	probably benign	Het
Kcp	A	T	6: 29,490,439	I1002N	probably benign	Het
Lrfn5	G	T	12: 61,840,592	E389*	probably null	Het
Lrp6	G	T	6: 134,542,045	A19E	probably benign	Het
Mad1l1	A	G	5: 140,300,560	L228P	probably damaging	Het
Map2	T	C	1: 66,425,189		probably benign	Het
Mgam	A	G	6: 40,754,935	N735S	probably benign	Het
Mid2	A	G	X: 140,763,676	Y618C	probably damaging	Het
Mllt11	G	A	3: 95,220,286	Q58*	probably null	Het
Mttp	A	G	3: 138,103,313	V678A	probably damaging	Het
Nfatc1	A	G	18: 80,697,910	S278P	probably damaging	Het
Ninj2	A	G	6: 120,198,137		probably benign	Het
Nsd3	T	A	8: 25,678,709		probably null	Het
Olfr1454	A	T	19: 13,063,738	E109V	probably damaging	Het
Olfr895	T	C	9: 38,269,125	V204A	possibly damaging	Het
Pcdhb4	A	G	18: 37,308,711	N358S	probably damaging	Het
Plch1	T	C	3: 63,702,553		probably benign	Het
Popdc3	T	C	10: 45,315,258	L155P	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm26	A	T	14: 105,176,782	I24N	unknown	Het
Rc3h2	T	A	2: 37,405,374	D210V	probably damaging	Het
Samd1	CGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	8: 83,998,996		probably benign	Het
Spopl	T	C	2: 23,537,521	T200A	probably benign	Het
Tarbp1	A	G	8: 126,438,801		probably null	Het
Thnsl1	T	A	2: 21,213,362	H121Q	probably damaging	Het
Tll1	T	C	8: 64,101,950	D233G	probably damaging	Het
Vmn2r27	A	T	6: 124,223,702	V432E	possibly damaging	Het
Wdr5	T	C	2: 27,519,412	S49P	probably damaging	Het
Zfyve26	A	T	12: 79,295,534	I46N	probably damaging	Het

Other mutations in Med13l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Med13l	APN	5	118724071	missense	probably damaging	0.99
IGL01012:Med13l	APN	5	118734028	missense	probably damaging	0.99
IGL01316:Med13l	APN	5	118762781	missense	probably damaging	1.00
IGL01529:Med13l	APN	5	118742335	missense	probably damaging	1.00
IGL01731:Med13l	APN	5	118742407	missense	probably benign	0.05
IGL01790:Med13l	APN	5	118593522	missense	probably damaging	1.00
IGL02394:Med13l	APN	5	118748833	missense	probably benign	0.37
IGL02432:Med13l	APN	5	118738400	missense	possibly damaging	0.90
IGL02698:Med13l	APN	5	118762829	missense	probably damaging	0.99
IGL02801:Med13l	APN	5	118745113	missense	probably damaging	1.00
IGL03242:Med13l	APN	5	118747445	missense	probably benign
IGL03270:Med13l	APN	5	118731430	missense	probably damaging	1.00
Basics	UTSW	5	118759264	critical splice donor site	probably null
Fundament	UTSW	5	118721474	missense	probably damaging	1.00
Root	UTSW	5	118593445	missense	probably damaging	1.00
P0035:Med13l	UTSW	5	118742620	missense	probably benign	0.00
R0051:Med13l	UTSW	5	118742655	missense	probably damaging	1.00
R0051:Med13l	UTSW	5	118742655	missense	probably damaging	1.00
R0136:Med13l	UTSW	5	118724050	missense	probably benign	0.15
R0158:Med13l	UTSW	5	118742449	missense	unknown
R0197:Med13l	UTSW	5	118671002	splice site	probably benign
R0370:Med13l	UTSW	5	118741826	missense	probably benign	0.14
R0492:Med13l	UTSW	5	118738495	missense	probably damaging	1.00
R0532:Med13l	UTSW	5	118759123	missense	possibly damaging	0.78
R0726:Med13l	UTSW	5	118748684	missense	probably damaging	0.99
R0827:Med13l	UTSW	5	118726247	splice site	probably benign
R0883:Med13l	UTSW	5	118671002	splice site	probably benign
R0959:Med13l	UTSW	5	118754285	missense	possibly damaging	0.89
R1458:Med13l	UTSW	5	118738459	missense	probably benign	0.00
R1562:Med13l	UTSW	5	118738519	missense	probably damaging	1.00
R1577:Med13l	UTSW	5	118721392	missense	probably damaging	1.00
R1661:Med13l	UTSW	5	118749748	missense	probably damaging	1.00
R1665:Med13l	UTSW	5	118749748	missense	probably damaging	1.00
R1720:Med13l	UTSW	5	118741995	missense	probably damaging	1.00
R1929:Med13l	UTSW	5	118728833	missense	probably benign	0.01
R1967:Med13l	UTSW	5	118761322	missense	probably damaging	0.99
R2301:Med13l	UTSW	5	118593447	missense	probably damaging	1.00
R3691:Med13l	UTSW	5	118721497	missense	probably benign	0.16
R3895:Med13l	UTSW	5	118761323	missense	probably null	0.99
R4043:Med13l	UTSW	5	118593463	missense	probably damaging	1.00
R4593:Med13l	UTSW	5	118742560	missense	probably damaging	1.00
R4902:Med13l	UTSW	5	118745130	missense	probably damaging	1.00
R4995:Med13l	UTSW	5	118730949	missense	possibly damaging	0.90
R5010:Med13l	UTSW	5	118593550	missense	possibly damaging	0.95
R5057:Med13l	UTSW	5	118718493	missense	probably damaging	1.00
R5369:Med13l	UTSW	5	118724010	missense	probably benign	0.02
R5446:Med13l	UTSW	5	118742397	missense	possibly damaging	0.81
R5564:Med13l	UTSW	5	118742040	missense	probably damaging	1.00
R5566:Med13l	UTSW	5	118728665	missense	possibly damaging	0.95
R5580:Med13l	UTSW	5	118751630	missense	possibly damaging	0.95
R5634:Med13l	UTSW	5	118560850	missense	possibly damaging	0.88
R5748:Med13l	UTSW	5	118593445	missense	probably damaging	1.00
R5764:Med13l	UTSW	5	118728642	missense	probably damaging	0.99
R5765:Med13l	UTSW	5	118728642	missense	probably damaging	0.99
R6083:Med13l	UTSW	5	118721486	missense	possibly damaging	0.80
R6504:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R6546:Med13l	UTSW	5	118721474	missense	probably damaging	1.00
R6797:Med13l	UTSW	5	118759264	critical splice donor site	probably null
R6911:Med13l	UTSW	5	118755658	missense	possibly damaging	0.95
R6942:Med13l	UTSW	5	118745006	splice site	probably null
R7018:Med13l	UTSW	5	118751986	missense	probably damaging	0.99
R7096:Med13l	UTSW	5	118721926	missense	possibly damaging	0.90
R7113:Med13l	UTSW	5	118726265	missense	probably benign	0.09
R7136:Med13l	UTSW	5	118721522	missense	possibly damaging	0.90
R7140:Med13l	UTSW	5	118741972	missense	probably benign	0.27
R7345:Med13l	UTSW	5	118742760	missense	probably damaging	1.00
R7409:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R7410:Med13l	UTSW	5	118560832	missense	possibly damaging	0.94
R7432:Med13l	UTSW	5	118751938	missense	probably damaging	0.99
R7486:Med13l	UTSW	5	118728474	missense	probably benign	0.17
R7509:Med13l	UTSW	5	118748930	missense	probably damaging	0.97
R7722:Med13l	UTSW	5	118747407	missense	probably benign	0.32
R7802:Med13l	UTSW	5	118728590	missense	probably benign	0.03
R8081:Med13l	UTSW	5	118728268	missense	probably damaging	1.00
R8260:Med13l	UTSW	5	118748729	missense	possibly damaging	0.95
R8266:Med13l	UTSW	5	118742109	missense	probably damaging	1.00
R8347:Med13l	UTSW	5	118742597	missense	probably benign
R8365:Med13l	UTSW	5	118728644	missense	possibly damaging	0.81
R8508:Med13l	UTSW	5	118754321	missense	probably benign	0.34
X0065:Med13l	UTSW	5	118729883	missense	probably damaging	1.00
Z1088:Med13l	UTSW	5	118749641	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGCTAAGTCATGCCTACCAGTCCC -3'
(R):5'- GCGCAGAGTTAACAGAAGCTGACC -3'

Sequencing Primer
(F):5'- ATAGGCCCCCATAGTTCATGC -3'
(R):5'- GTTAACAGAAGCTGACCCAATTAG -3'

Posted On

2013-09-30