Mutagenetix > Incidental Mutation

Incidental Mutation 'R9312:Trak1'

705656

Institutional Source

Beutler Lab

Gene Symbol

Trak1

Ensembl Gene

ENSMUSG00000032536

Gene Name

trafficking protein, kinesin binding 1

Synonyms

hyrt, 2310001H13Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R9312 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121297502-121474918 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121451691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 382 (E382G)

Ref Sequence

ENSEMBL: ENSMUSP00000044482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000210351] [ENSMUST00000210798] [ENSMUST00000211187] [ENSMUST00000211301] [ENSMUST00000211439]

AlphaFold

Q6PD31

Predicted Effect

probably benign
Transcript: ENSMUST00000045903
AA Change: E382G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: E382G

Domain	Start	End	E-Value	Type
Pfam:HAP1_N	47	352	8.1e-139	PFAM
Pfam:Milton	411	580	5e-72	PFAM
low complexity region	882	897	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209446

Predicted Effect

probably benign
Transcript: ENSMUST00000210351

Predicted Effect

probably damaging
Transcript: ENSMUST00000210798
AA Change: E279G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211187
AA Change: E372G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211301
AA Change: E279G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211439
AA Change: E279G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam8	A	G	7: 139,985,878	L607P	probably damaging	Het
Adamts16	T	A	13: 70,800,926	R205S	probably damaging	Het
Adgra3	T	C	5: 49,960,558	Y1216C	probably damaging	Het
Arl3	A	G	19: 46,543,525	V91A	probably damaging	Het
Bckdhb	A	T	9: 83,988,780	K114N	probably benign	Het
Cabin1	A	T	10: 75,725,735	D150E	probably benign	Het
Cadps	G	A	14: 12,616,095	R312C	probably damaging	Het
Cep120	A	G	18: 53,727,641	I239T	probably benign	Het
Clec4g	T	A	8: 3,718,371	E120V	probably null	Het
Col18a1	T	C	10: 77,058,772	E1022G	probably damaging	Het
Cyfip2	A	G	11: 46,276,882	I231T	possibly damaging	Het
Dcaf17	T	C	2: 71,078,114	Y228H	probably benign	Het
Ddx41	T	A	13: 55,536,029	Q52L	probably benign	Het
Dync2h1	T	C	9: 7,050,413	Y3212C	probably damaging	Het
Etv4	A	G	11: 101,774,097	Y177H	probably benign	Het
Fer1l5	A	G	1: 36,421,167	E1910G	probably damaging	Het
Fgf11	G	T	11: 69,798,586	H195Q	probably damaging	Het
Gatb	A	G	3: 85,653,763	K529E	probably damaging	Het
Gsdmc	C	A	15: 63,777,957	A362S	probably damaging	Het
Gucy1b1	A	T	3: 82,034,816	N545K	probably damaging	Het
Heatr1	A	G	13: 12,431,684	H1638R	probably benign	Het
Hecw1	T	G	13: 14,371,982	I145L	probably damaging	Het
Hmmr	A	G	11: 40,723,489	V124A	possibly damaging	Het
Il31ra	C	T	13: 112,549,489	V89I	probably benign	Het
Kcnmb3	A	T	3: 32,482,426	M51K	probably benign	Het
Lamb1	C	T	12: 31,318,353	R1209C	probably damaging	Het
Lcn6	G	T	2: 25,680,062	G80V	probably benign	Het
Lgsn	A	G	1: 31,204,199	E454G	probably benign	Het
Loxhd1	G	A	18: 77,410,589	M1624I	probably benign	Het
Ltbp2	G	A	12: 84,791,090	P1192L	probably benign	Het
Mapk8ip3	T	C	17: 24,927,951		probably null	Het
Mlip	A	G	9: 77,239,778	Y26H	probably damaging	Het
Nipsnap1	A	C	11: 4,889,902	I208L	possibly damaging	Het
Nusap1	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	2: 119,627,638		probably benign	Het
Olfr1028	T	A	2: 85,951,165	V34D	possibly damaging	Het
Pigr	C	T	1: 130,834,448	T7M	probably benign	Het
Pigu	T	C	2: 155,357,395	M1V	probably null	Het
Pkd1	T	A	17: 24,578,390	I2568N	probably damaging	Het
Psmd4	A	T	3: 95,033,418	S345T	probably benign	Het
Rab3gap2	A	T	1: 185,283,487	M1321L	probably benign	Het
Rnf157	A	G	11: 116,349,332		probably null	Het
Sart3	C	T	5: 113,762,874	E168K	possibly damaging	Het
Scnn1g	A	G	7: 121,740,595	K206E	probably benign	Het
Smg6	A	C	11: 74,930,051	S383R	probably benign	Het
Smurf1	G	T	5: 144,894,083	P294H	probably damaging	Het
Sspo	A	T	6: 48,468,462	H2279L	probably benign	Het
Tacc2	A	T	7: 130,622,248	D221V	probably benign	Het
Tgm6	T	A	2: 130,135,781	H13Q	probably benign	Het
Tnfaip8l2	T	C	3: 95,140,456	D32G	probably damaging	Het
Tppp	A	G	13: 74,031,258	D167G	probably damaging	Het
Trdv2-1	C	T	14: 53,946,113	T14I	probably benign	Het
Tsta3	T	C	15: 75,925,320	Y292C	possibly damaging	Het
Ubr3	A	T	2: 69,954,333	D799V	probably damaging	Het
Usp28	T	A	9: 49,015,139	Y317*	probably null	Het
Vmn1r225	C	T	17: 20,502,698	L134F	probably benign	Het
Vmn2r86	A	G	10: 130,452,537	I365T	probably benign	Het
Wfikkn2	A	G	11: 94,238,671	S215P	probably damaging	Het
Xrcc2	A	G	5: 25,692,126	V275A	probably damaging	Het
Zfp423	T	A	8: 87,781,941	I592F	probably damaging	Het

Other mutations in Trak1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Trak1	APN	9	121443736	critical splice donor site	probably null
IGL01335:Trak1	APN	9	121454316	missense	possibly damaging	0.58
IGL01777:Trak1	APN	9	121431560	splice site	probably null
IGL01804:Trak1	APN	9	121442685	splice site	probably benign
IGL01986:Trak1	APN	9	121472967	missense	probably benign	0.00
IGL02248:Trak1	APN	9	121446794	missense	probably damaging	1.00
IGL02276:Trak1	APN	9	121451668	missense	probably damaging	1.00
IGL02556:Trak1	APN	9	121448901	missense	probably damaging	1.00
IGL03368:Trak1	APN	9	121367122	missense	possibly damaging	0.66
PIT4468001:Trak1	UTSW	9	121453332	missense	probably benign	0.18
R0067:Trak1	UTSW	9	121472907	missense	probably damaging	1.00
R0276:Trak1	UTSW	9	121454338	missense	probably damaging	0.97
R0535:Trak1	UTSW	9	121443712	missense	probably null	1.00
R0629:Trak1	UTSW	9	121367167	missense	probably benign	0.37
R0671:Trak1	UTSW	9	121448955	critical splice donor site	probably null
R0883:Trak1	UTSW	9	121453285	missense	possibly damaging	0.90
R1160:Trak1	UTSW	9	121392007	missense	probably benign	0.01
R1162:Trak1	UTSW	9	121453341	missense	possibly damaging	0.93
R1168:Trak1	UTSW	9	121440679	missense	probably damaging	1.00
R1398:Trak1	UTSW	9	121454359	missense	probably damaging	1.00
R2118:Trak1	UTSW	9	121472997	makesense	probably null
R2119:Trak1	UTSW	9	121472997	makesense	probably null
R2120:Trak1	UTSW	9	121472997	makesense	probably null
R2137:Trak1	UTSW	9	121472962	missense	possibly damaging	0.83
R3162:Trak1	UTSW	9	121451734	splice site	probably benign
R3888:Trak1	UTSW	9	121442797	splice site	probably null
R3889:Trak1	UTSW	9	121445873	missense	probably null	0.40
R4031:Trak1	UTSW	9	121451670	missense	probably damaging	1.00
R4116:Trak1	UTSW	9	121448843	missense	probably damaging	1.00
R4406:Trak1	UTSW	9	121431536	missense	probably damaging	1.00
R4630:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4631:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4632:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4786:Trak1	UTSW	9	121472494	missense	probably benign	0.25
R5137:Trak1	UTSW	9	121367055	intron	probably benign
R5159:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R5467:Trak1	UTSW	9	121446798	missense	probably damaging	1.00
R5661:Trak1	UTSW	9	121443637	missense	possibly damaging	0.46
R5664:Trak1	UTSW	9	121472307	missense	possibly damaging	0.47
R5769:Trak1	UTSW	9	121448838	missense	probably damaging	1.00
R6041:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R6257:Trak1	UTSW	9	121446755	missense	probably damaging	1.00
R6257:Trak1	UTSW	9	121367224	missense	possibly damaging	0.92
R6354:Trak1	UTSW	9	121451726	missense	probably null	0.03
R6399:Trak1	UTSW	9	121453496	splice site	probably null
R6513:Trak1	UTSW	9	121443756	missense	probably benign
R6579:Trak1	UTSW	9	121443638	missense	probably benign	0.29
R6940:Trak1	UTSW	9	121443718	missense	possibly damaging	0.78
R7120:Trak1	UTSW	9	121460498	missense	probably benign
R7299:Trak1	UTSW	9	121451863	splice site	probably null
R7304:Trak1	UTSW	9	121416212	missense	probably benign
R7396:Trak1	UTSW	9	121448907	missense	possibly damaging	0.71
R7522:Trak1	UTSW	9	121442711	missense	probably damaging	0.99
R7657:Trak1	UTSW	9	121472586	missense	probably damaging	1.00
R7733:Trak1	UTSW	9	121367225	missense	possibly damaging	0.92
R7793:Trak1	UTSW	9	121416198	nonsense	probably null
R7999:Trak1	UTSW	9	121460425	missense	probably damaging	1.00
R8209:Trak1	UTSW	9	121451727	missense	probably benign
R8215:Trak1	UTSW	9	121469030	missense	probably damaging	1.00
R8226:Trak1	UTSW	9	121451727	missense	probably benign
R8261:Trak1	UTSW	9	121451667	missense	probably damaging	1.00
R8300:Trak1	UTSW	9	121460499	nonsense	probably null
R8914:Trak1	UTSW	9	121443781	missense	unknown
R9072:Trak1	UTSW	9	121460488	missense	probably damaging	1.00
R9073:Trak1	UTSW	9	121460488	missense	probably damaging	1.00
R9366:Trak1	UTSW	9	121472512	missense	probably damaging	1.00
R9663:Trak1	UTSW	9	121391858	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- CATGGCTTGGCAGATTCTCTC -3'
(R):5'- CCAGCCTTAGAGAGATGTCAC -3'

Sequencing Primer
(F):5'- CAGATTCTCTCTGTGTAGGGATTGC -3'
(R):5'- CAGCCTTAGAGAGATGTCACTGTATC -3'

Posted On

2022-03-25