Incidental Mutation 'R9313:1700006A11Rik'
ID 705699
Institutional Source Beutler Lab
Gene Symbol 1700006A11Rik
Ensembl Gene ENSMUSG00000027973
Gene Name RIKEN cDNA 1700006A11 gene
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R9313 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 124194639-124219688 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124207220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 324 (T324A)
Ref Sequence ENSEMBL: ENSMUSP00000029598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029598] [ENSMUST00000198630]
AlphaFold B9EHI3
Predicted Effect probably benign
Transcript: ENSMUST00000029598
AA Change: T324A

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029598
Gene: ENSMUSG00000027973
AA Change: T324A

DomainStartEndE-ValueType
RhoGAP 78 251 3.63e-37 SMART
RhoGAP 377 543 3.19e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat G A 8: 60,979,635 (GRCm39) V166I probably benign Het
Abca17 C T 17: 24,565,207 (GRCm39) S75N probably benign Het
Adgrb1 A G 15: 74,411,624 (GRCm39) T376A probably damaging Het
Atp5po CTTTGACG C 16: 91,723,804 (GRCm39) probably null Het
Atp5po TTTGACGGT TT 16: 91,723,805 (GRCm39) probably null Het
Car9 A G 4: 43,507,180 (GRCm39) E42G probably benign Het
Ccdc168 A G 1: 44,096,520 (GRCm39) V1526A probably benign Het
Cep41 T C 6: 30,680,345 (GRCm39) K9R probably null Het
Cfap20dc T A 14: 8,518,635 (GRCm38) T274S probably benign Het
Ckm A G 7: 19,149,398 (GRCm39) T141A probably benign Het
Clcc1 G T 3: 108,581,976 (GRCm39) R360S probably benign Het
Clcn3 A C 8: 61,390,503 (GRCm39) I146R probably damaging Het
Crlf1 A G 8: 70,951,466 (GRCm39) D115G probably damaging Het
Dnah1 T A 14: 30,987,970 (GRCm39) I3483F probably damaging Het
Dop1a T C 9: 86,406,641 (GRCm39) *386Q probably null Het
Eftud2 A G 11: 102,730,262 (GRCm39) V899A probably benign Het
Ephx3 C G 17: 32,408,290 (GRCm39) D45H probably benign Het
Faap100 A G 11: 120,267,688 (GRCm39) S362P probably damaging Het
Fdps A T 3: 89,006,655 (GRCm39) D78E probably benign Het
Fsd1l T G 4: 53,694,760 (GRCm39) W405G probably damaging Het
Fsd1l T C 4: 53,701,093 (GRCm39) V485A possibly damaging Het
Gm12887 C T 4: 121,473,701 (GRCm39) V50M probably benign Het
Gm45785 T C 7: 140,398,616 (GRCm39) I94V unknown Het
Hcls1 C T 16: 36,777,000 (GRCm39) A230V probably benign Het
Hmcn1 A C 1: 150,522,343 (GRCm39) V3519G probably benign Het
Hmgcs1 A G 13: 120,165,963 (GRCm39) Y360C probably benign Het
Hsd17b13 A G 5: 104,113,639 (GRCm39) probably null Het
Ift57 T A 16: 49,557,085 (GRCm39) D235E possibly damaging Het
Il22b A G 10: 118,130,138 (GRCm39) C89R probably damaging Het
Iqcn G A 8: 71,161,353 (GRCm39) G182D probably damaging Het
Krt9 T A 11: 100,079,547 (GRCm39) Y615F unknown Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Marco T C 1: 120,421,814 (GRCm39) E130G probably damaging Het
Ms4a18 A T 19: 10,988,804 (GRCm39) L184Q probably damaging Het
Mtus1 A T 8: 41,535,923 (GRCm39) S598T probably damaging Het
Nbeal2 C A 9: 110,463,436 (GRCm39) R1265L probably damaging Het
Odf2 G T 2: 29,816,815 (GRCm39) G754C probably benign Het
Or2m12 T G 16: 19,105,100 (GRCm39) Y131S probably benign Het
Or4x13 C A 2: 90,231,917 (GRCm39) T304K probably benign Het
Or5w11 T C 2: 87,459,076 (GRCm39) S90P probably benign Het
Or6c69b A T 10: 129,626,789 (GRCm39) I223N probably damaging Het
Paqr8 G A 1: 21,005,128 (GRCm39) W94* probably null Het
Pkd1 G A 17: 24,813,932 (GRCm39) G4132D probably damaging Het
Pom121l2 A G 13: 22,168,506 (GRCm39) M926V probably benign Het
Postn A T 3: 54,273,336 (GRCm39) Y79F probably damaging Het
Prl7d1 T C 13: 27,893,182 (GRCm39) E242G probably benign Het
Rcor3 G T 1: 191,810,181 (GRCm39) H165Q possibly damaging Het
Rnf157 A G 11: 116,250,718 (GRCm39) V161A probably damaging Het
Rnf38 G A 4: 44,143,584 (GRCm39) T150M probably damaging Het
Scn4b T A 9: 45,058,013 (GRCm39) V35E probably damaging Het
Serpina3i T C 12: 104,231,672 (GRCm39) I103T probably damaging Het
Shcbp1 T A 8: 4,794,518 (GRCm39) D425V probably damaging Het
Sidt2 T C 9: 45,852,658 (GRCm39) T776A possibly damaging Het
Siglecg A G 7: 43,061,856 (GRCm39) D534G probably benign Het
Sipa1l3 T A 7: 29,077,439 (GRCm39) T778S probably benign Het
Slc13a1 A G 6: 24,108,203 (GRCm39) V291A probably benign Het
Stra6l A G 4: 45,881,454 (GRCm39) I439V probably benign Het
Tdrd7 G A 4: 46,005,319 (GRCm39) S375N probably benign Het
Tut7 A T 13: 59,947,798 (GRCm39) M841K probably benign Het
Vmn1r192 T A 13: 22,372,191 (GRCm39) I10L probably benign Het
Vmn2r34 T G 7: 7,686,817 (GRCm39) L293F possibly damaging Het
Xirp2 G T 2: 67,347,322 (GRCm39) A3188S probably damaging Het
Zfp219 A G 14: 52,246,200 (GRCm39) V309A probably damaging Het
Zfp341 C A 2: 154,469,907 (GRCm39) P197T probably damaging Het
Zfp628 G A 7: 4,922,549 (GRCm39) R257H probably benign Het
Zfp644 T G 5: 106,784,324 (GRCm39) Y741S probably benign Het
Other mutations in 1700006A11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:1700006A11Rik APN 3 124,195,058 (GRCm39) missense probably benign 0.30
IGL02552:1700006A11Rik APN 3 124,208,145 (GRCm39) missense probably damaging 1.00
IGL03092:1700006A11Rik APN 3 124,200,119 (GRCm39) missense probably damaging 1.00
R0094:1700006A11Rik UTSW 3 124,203,427 (GRCm39) splice site probably benign
R0097:1700006A11Rik UTSW 3 124,206,129 (GRCm39) missense probably benign 0.13
R0097:1700006A11Rik UTSW 3 124,206,129 (GRCm39) missense probably benign 0.13
R0184:1700006A11Rik UTSW 3 124,212,899 (GRCm39) missense probably damaging 1.00
R0361:1700006A11Rik UTSW 3 124,207,283 (GRCm39) missense possibly damaging 0.69
R1542:1700006A11Rik UTSW 3 124,208,055 (GRCm39) missense possibly damaging 0.95
R1549:1700006A11Rik UTSW 3 124,210,441 (GRCm39) missense probably benign 0.00
R1779:1700006A11Rik UTSW 3 124,200,163 (GRCm39) missense probably damaging 0.99
R1839:1700006A11Rik UTSW 3 124,203,369 (GRCm39) missense probably damaging 0.99
R1986:1700006A11Rik UTSW 3 124,212,977 (GRCm39) missense probably damaging 0.99
R2042:1700006A11Rik UTSW 3 124,210,377 (GRCm39) splice site probably benign
R2149:1700006A11Rik UTSW 3 124,203,335 (GRCm39) missense probably benign 0.33
R2258:1700006A11Rik UTSW 3 124,207,267 (GRCm39) missense possibly damaging 0.84
R2291:1700006A11Rik UTSW 3 124,207,450 (GRCm39) missense probably damaging 1.00
R2509:1700006A11Rik UTSW 3 124,200,102 (GRCm39) missense probably benign 0.44
R4912:1700006A11Rik UTSW 3 124,213,505 (GRCm39) missense possibly damaging 0.68
R5074:1700006A11Rik UTSW 3 124,210,482 (GRCm39) missense probably benign 0.01
R5303:1700006A11Rik UTSW 3 124,199,999 (GRCm39) missense probably damaging 1.00
R5307:1700006A11Rik UTSW 3 124,199,999 (GRCm39) missense probably damaging 1.00
R5308:1700006A11Rik UTSW 3 124,199,999 (GRCm39) missense probably damaging 1.00
R5796:1700006A11Rik UTSW 3 124,215,077 (GRCm39) missense possibly damaging 0.66
R6018:1700006A11Rik UTSW 3 124,210,448 (GRCm39) missense probably damaging 1.00
R6198:1700006A11Rik UTSW 3 124,210,499 (GRCm39) splice site probably null
R6504:1700006A11Rik UTSW 3 124,213,569 (GRCm39) missense probably benign
R7124:1700006A11Rik UTSW 3 124,208,042 (GRCm39) missense probably benign 0.04
R7248:1700006A11Rik UTSW 3 124,207,959 (GRCm39) critical splice donor site probably null
R7351:1700006A11Rik UTSW 3 124,206,159 (GRCm39) missense probably damaging 1.00
R7709:1700006A11Rik UTSW 3 124,201,334 (GRCm39) missense probably damaging 1.00
R7773:1700006A11Rik UTSW 3 124,206,180 (GRCm39) missense probably benign 0.00
R8193:1700006A11Rik UTSW 3 124,213,517 (GRCm39) missense possibly damaging 0.84
R8201:1700006A11Rik UTSW 3 124,195,046 (GRCm39) missense probably benign 0.00
R9157:1700006A11Rik UTSW 3 124,207,220 (GRCm39) missense probably benign 0.22
R9585:1700006A11Rik UTSW 3 124,199,993 (GRCm39) missense possibly damaging 0.73
R9683:1700006A11Rik UTSW 3 124,200,095 (GRCm39) missense probably benign 0.01
R9721:1700006A11Rik UTSW 3 124,212,932 (GRCm39) missense probably benign 0.00
X0063:1700006A11Rik UTSW 3 124,213,511 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTTTACATATACTCAGGACCAC -3'
(R):5'- TTTACGTTATGATGCAAGCTCAGTG -3'

Sequencing Primer
(F):5'- GGGGATAAAAATTTACAGGCAGTTTC -3'
(R):5'- GATGCAAGCTCAGTGTCTTGCC -3'
Posted On 2022-03-25