Incidental Mutation 'R0738:Vmn2r27'
ID70571
Institutional Source Beutler Lab
Gene Symbol Vmn2r27
Ensembl Gene ENSMUSG00000072778
Gene Namevomeronasal 2, receptor27
SynonymsEG232367
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124191596-124231784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124223702 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 432 (V432E)
Ref Sequence ENSEMBL: ENSMUSP00000098528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100968]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100968
AA Change: V432E

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098528
Gene: ENSMUSG00000072778
AA Change: V432E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 81 475 1.1e-27 PFAM
Pfam:NCD3G 519 570 1.3e-18 PFAM
Pfam:7tm_3 603 838 2.6e-50 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Vmn2r27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Vmn2r27 APN 6 124192411 missense possibly damaging 0.86
IGL01388:Vmn2r27 APN 6 124223832 missense possibly damaging 0.55
IGL01923:Vmn2r27 APN 6 124200525 missense probably benign 0.20
IGL01954:Vmn2r27 APN 6 124192248 missense probably damaging 1.00
IGL02105:Vmn2r27 APN 6 124197349 splice site probably benign
IGL02586:Vmn2r27 APN 6 124224475 nonsense probably null
IGL03130:Vmn2r27 APN 6 124192317 missense possibly damaging 0.82
IGL03330:Vmn2r27 APN 6 124230180 nonsense probably null
R0124:Vmn2r27 UTSW 6 124231619 missense probably benign
R0234:Vmn2r27 UTSW 6 124231619 missense probably benign
R0234:Vmn2r27 UTSW 6 124231619 missense probably benign
R0384:Vmn2r27 UTSW 6 124223912 missense probably benign 0.01
R0582:Vmn2r27 UTSW 6 124224290 missense probably benign 0.02
R0733:Vmn2r27 UTSW 6 124192188 missense probably benign 0.18
R0835:Vmn2r27 UTSW 6 124200624 missense probably damaging 0.99
R1183:Vmn2r27 UTSW 6 124200532 missense probably benign
R1401:Vmn2r27 UTSW 6 124191632 nonsense probably null
R1484:Vmn2r27 UTSW 6 124200515 missense probably damaging 0.96
R1536:Vmn2r27 UTSW 6 124200690 missense probably damaging 1.00
R1539:Vmn2r27 UTSW 6 124191771 missense probably damaging 1.00
R1565:Vmn2r27 UTSW 6 124231634 missense probably benign
R1595:Vmn2r27 UTSW 6 124231615 missense probably benign 0.00
R1614:Vmn2r27 UTSW 6 124223934 missense probably benign 0.01
R1742:Vmn2r27 UTSW 6 124200677 missense possibly damaging 0.48
R1816:Vmn2r27 UTSW 6 124230371 nonsense probably null
R1822:Vmn2r27 UTSW 6 124231634 missense probably benign
R1824:Vmn2r27 UTSW 6 124231634 missense probably benign
R1870:Vmn2r27 UTSW 6 124224211 missense probably benign 0.11
R1942:Vmn2r27 UTSW 6 124223763 missense probably damaging 1.00
R1962:Vmn2r27 UTSW 6 124223834 missense possibly damaging 0.70
R2069:Vmn2r27 UTSW 6 124224483 missense probably damaging 1.00
R2075:Vmn2r27 UTSW 6 124200551 missense possibly damaging 0.85
R2379:Vmn2r27 UTSW 6 124224383 missense possibly damaging 0.89
R3748:Vmn2r27 UTSW 6 124230392 missense probably benign 0.35
R4384:Vmn2r27 UTSW 6 124224156 missense probably benign 0.05
R4392:Vmn2r27 UTSW 6 124230176 missense probably benign 0.01
R4758:Vmn2r27 UTSW 6 124231637 missense possibly damaging 0.87
R5018:Vmn2r27 UTSW 6 124224182 missense probably benign 0.02
R5235:Vmn2r27 UTSW 6 124192054 missense probably damaging 0.99
R5718:Vmn2r27 UTSW 6 124192144 missense possibly damaging 0.66
R5859:Vmn2r27 UTSW 6 124200688 missense probably damaging 1.00
R5958:Vmn2r27 UTSW 6 124231727 missense probably benign 0.00
R6044:Vmn2r27 UTSW 6 124231772 missense probably benign
R6086:Vmn2r27 UTSW 6 124191999 missense probably damaging 1.00
R6396:Vmn2r27 UTSW 6 124224166 nonsense probably null
R6546:Vmn2r27 UTSW 6 124192410 missense possibly damaging 0.49
R6746:Vmn2r27 UTSW 6 124200593 missense possibly damaging 0.47
R6976:Vmn2r27 UTSW 6 124224353 nonsense probably null
R7091:Vmn2r27 UTSW 6 124223945 missense possibly damaging 0.85
R7145:Vmn2r27 UTSW 6 124191752 missense probably benign
R7176:Vmn2r27 UTSW 6 124192036 missense probably benign 0.01
R7382:Vmn2r27 UTSW 6 124197317 missense probably damaging 1.00
R7482:Vmn2r27 UTSW 6 124224261 missense probably damaging 1.00
R7853:Vmn2r27 UTSW 6 124192021 missense probably damaging 1.00
R7859:Vmn2r27 UTSW 6 124224242 missense probably benign 0.00
R7936:Vmn2r27 UTSW 6 124192021 missense probably damaging 1.00
R7942:Vmn2r27 UTSW 6 124224242 missense probably benign 0.00
Z1177:Vmn2r27 UTSW 6 124191901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCAGTTCTGAAGAATCACGCAC -3'
(R):5'- ATGTGAGCCAAATGGCAGCCTG -3'

Sequencing Primer
(F):5'- GTTCTGAAGAATCACGCACATATTG -3'
(R):5'- AATGGCAGCCTGAGCAC -3'
Posted On2013-09-30