Incidental Mutation 'R0738:Cd9'
ID70572
Institutional Source Beutler Lab
Gene Symbol Cd9
Ensembl Gene ENSMUSG00000030342
Gene NameCD9 antigen
SynonymsTspan29
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125460266-125494791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 125462140 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 169 (Q169K)
Ref Sequence ENSEMBL: ENSMUSP00000032492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032492]
Predicted Effect probably benign
Transcript: ENSMUST00000032492
AA Change: Q169K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032492
Gene: ENSMUSG00000030342
AA Change: Q169K

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 219 2.9e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140024
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins are cell surface glycoproteins with four transmembrane domains that form multimeric complexes with other cell surface proteins. The encoded protein functions in many cellular processes including differentiation, adhesion, and signal transduction, and expression of this gene plays a critical role in the suppression of cancer cell motility and metastasis. [provided by RefSeq, Jan 2011]
PHENOTYPE: Females homozygous for targeted null mutations are infertile due to lack of sperm-egg fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Cd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02496:Cd9 APN 6 125472495 missense probably damaging 1.00
R0255:Cd9 UTSW 6 125463740 missense probably damaging 1.00
R0472:Cd9 UTSW 6 125472433 missense probably benign
R1697:Cd9 UTSW 6 125464404 missense probably damaging 0.98
R2085:Cd9 UTSW 6 125463771 splice site probably null
R4201:Cd9 UTSW 6 125462394 missense possibly damaging 0.56
R4961:Cd9 UTSW 6 125463740 missense probably damaging 1.00
R5580:Cd9 UTSW 6 125464457 missense probably damaging 1.00
R6627:Cd9 UTSW 6 125462412 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCAAGCATTCTGCCACTCAAAGAGG -3'
(R):5'- TTACGGAGCAAGGATGAACCCCAG -3'

Sequencing Primer
(F):5'- cactCAAAGAGGCCCCTCTG -3'
(R):5'- ATATGGCGGTAGGTCACCTC -3'
Posted On2013-09-30