Incidental Mutation 'R9313:Prl7d1'
ID 705737
Institutional Source Beutler Lab
Gene Symbol Prl7d1
Ensembl Gene ENSMUSG00000021348
Gene Name prolactin family 7, subfamily d, member 1
Synonyms Plfr, PRP, PLF-RP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9313 (G1)
Quality Score 220.009
Status Not validated
Chromosome 13
Chromosomal Location 27706337-27716736 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27709199 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 242 (E242G)
Ref Sequence ENSEMBL: ENSMUSP00000021776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021776] [ENSMUST00000224026]
AlphaFold P04769
Predicted Effect probably benign
Transcript: ENSMUST00000021776
AA Change: E242G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021776
Gene: ENSMUSG00000021348
AA Change: E242G

DomainStartEndE-ValueType
Pfam:Hormone_1 17 240 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224026
AA Change: E243G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,413,571 T324A probably benign Het
4930452B06Rik T A 14: 8,518,635 T274S probably benign Het
Aadat G A 8: 60,526,601 V166I probably benign Het
Abca17 C T 17: 24,346,233 S75N probably benign Het
Adgrb1 A G 15: 74,539,775 T376A probably damaging Het
Atp5o CTTTGACG C 16: 91,926,916 probably null Het
Atp5o TTTGACGGT TT 16: 91,926,917 probably null Het
Car9 A G 4: 43,507,180 E42G probably benign Het
Cep41 T C 6: 30,680,346 K9R probably null Het
Ckm A G 7: 19,415,473 T141A probably benign Het
Clcc1 G T 3: 108,674,660 R360S probably benign Het
Clcn3 A C 8: 60,937,469 I146R probably damaging Het
Crlf1 A G 8: 70,498,816 D115G probably damaging Het
Dnah1 T A 14: 31,266,013 I3483F probably damaging Het
Dopey1 T C 9: 86,524,588 *386Q probably null Het
Eftud2 A G 11: 102,839,436 V899A probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Faap100 A G 11: 120,376,862 S362P probably damaging Het
Fdps A T 3: 89,099,348 D78E probably benign Het
Fsd1l T G 4: 53,694,760 W405G probably damaging Het
Fsd1l T C 4: 53,701,093 V485A possibly damaging Het
Gm12887 C T 4: 121,616,504 V50M probably benign Het
Gm16486 G A 8: 70,708,704 G182D probably damaging Het
Gm45785 T C 7: 140,818,703 I94V unknown Het
Gm8251 A G 1: 44,057,360 V1526A probably benign Het
Hcls1 C T 16: 36,956,638 A230V probably benign Het
Hmcn1 A C 1: 150,646,592 V3519G probably benign Het
Hmgcs1 A G 13: 119,704,427 Y360C probably benign Het
Hsd17b13 A G 5: 103,965,773 probably null Het
Ift57 T A 16: 49,736,722 D235E possibly damaging Het
Iltifb A G 10: 118,294,233 C89R probably damaging Het
Krt9 T A 11: 100,188,721 Y615F unknown Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Marco T C 1: 120,494,085 E130G probably damaging Het
Ms4a18 A T 19: 11,011,440 L184Q probably damaging Het
Mtus1 A T 8: 41,082,886 S598T probably damaging Het
Nbeal2 C A 9: 110,634,368 R1265L probably damaging Het
Odf2 G T 2: 29,926,803 G754C probably benign Het
Olfr1131 T C 2: 87,628,732 S90P probably benign Het
Olfr1274-ps C A 2: 90,401,573 T304K probably benign Het
Olfr164 T G 16: 19,286,350 Y131S probably benign Het
Olfr810 A T 10: 129,790,920 I223N probably damaging Het
Paqr8 G A 1: 20,934,904 W94* probably null Het
Pkd1 G A 17: 24,594,958 G4132D probably damaging Het
Pom121l2 A G 13: 21,984,336 M926V probably benign Het
Postn A T 3: 54,365,915 Y79F probably damaging Het
Rcor3 G T 1: 192,125,881 H165Q possibly damaging Het
Rnf157 A G 11: 116,359,892 V161A probably damaging Het
Rnf38 G A 4: 44,143,584 T150M probably damaging Het
Scn4b T A 9: 45,146,715 V35E probably damaging Het
Serpina3i T C 12: 104,265,413 I103T probably damaging Het
Shcbp1 T A 8: 4,744,518 D425V probably damaging Het
Sidt2 T C 9: 45,941,360 T776A possibly damaging Het
Siglecg A G 7: 43,412,432 D534G probably benign Het
Sipa1l3 T A 7: 29,378,014 T778S probably benign Het
Slc13a1 A G 6: 24,108,204 V291A probably benign Het
Stra6l A G 4: 45,881,454 I439V probably benign Het
Tdrd7 G A 4: 46,005,319 S375N probably benign Het
Vmn1r192 T A 13: 22,188,021 I10L probably benign Het
Vmn2r34 T G 7: 7,683,818 L293F possibly damaging Het
Xirp2 G T 2: 67,516,978 A3188S probably damaging Het
Zcchc6 A T 13: 59,799,984 M841K probably benign Het
Zfp219 A G 14: 52,008,743 V309A probably damaging Het
Zfp341 C A 2: 154,627,987 P197T probably damaging Het
Zfp628 G A 7: 4,919,550 R257H probably benign Het
Zfp644 T G 5: 106,636,458 Y741S probably benign Het
Other mutations in Prl7d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Prl7d1 APN 13 27710166 missense possibly damaging 0.91
IGL01735:Prl7d1 APN 13 27714389 missense possibly damaging 0.83
IGL02139:Prl7d1 APN 13 27712083 missense probably damaging 1.00
PIT4305001:Prl7d1 UTSW 13 27714337 missense possibly damaging 0.90
PIT4531001:Prl7d1 UTSW 13 27710178 missense probably damaging 1.00
R0555:Prl7d1 UTSW 13 27712055 missense probably benign 0.13
R0625:Prl7d1 UTSW 13 27710140 missense probably benign 0.10
R0631:Prl7d1 UTSW 13 27710182 missense probably benign 0.32
R0837:Prl7d1 UTSW 13 27714338 missense probably benign 0.06
R1403:Prl7d1 UTSW 13 27709197 missense possibly damaging 0.89
R1403:Prl7d1 UTSW 13 27709197 missense possibly damaging 0.89
R1459:Prl7d1 UTSW 13 27709257 missense possibly damaging 0.81
R1643:Prl7d1 UTSW 13 27712131 missense possibly damaging 0.53
R1691:Prl7d1 UTSW 13 27709382 missense probably damaging 0.97
R2016:Prl7d1 UTSW 13 27710173 missense probably damaging 1.00
R3873:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R3874:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R5251:Prl7d1 UTSW 13 27709244 missense probably benign 0.33
R5275:Prl7d1 UTSW 13 27709247 missense probably damaging 0.99
R5295:Prl7d1 UTSW 13 27709247 missense probably damaging 0.99
R5398:Prl7d1 UTSW 13 27710074 missense probably damaging 1.00
R6798:Prl7d1 UTSW 13 27709397 critical splice acceptor site probably null
R6818:Prl7d1 UTSW 13 27714471 missense probably benign 0.07
R6825:Prl7d1 UTSW 13 27710142 missense probably benign 0.01
R7478:Prl7d1 UTSW 13 27710185 nonsense probably null
R7795:Prl7d1 UTSW 13 27709280 missense probably damaging 1.00
R7995:Prl7d1 UTSW 13 27710071 missense probably benign
R8193:Prl7d1 UTSW 13 27709247 missense
R9424:Prl7d1 UTSW 13 27710202 missense probably benign 0.00
R9430:Prl7d1 UTSW 13 27714377 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTTAAGCCACAGAAGAATGCTG -3'
(R):5'- ATGAAGACTACCCGACCTGGTC -3'

Sequencing Primer
(F):5'- TCAACAGCTGAAAATGAGTTGAG -3'
(R):5'- CAGATTTGGACTCCCTGAAGTCAG -3'
Posted On 2022-03-25