Incidental Mutation 'R9313:Abca17'
ID 705749
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9313 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 24264259-24351029 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24346233 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 75 (S75N)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect probably benign
Transcript: ENSMUST00000039324
AA Change: S75N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: S75N

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121226
AA Change: S75N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: S75N

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,413,571 T324A probably benign Het
4930452B06Rik T A 14: 8,518,635 T274S probably benign Het
Aadat G A 8: 60,526,601 V166I probably benign Het
Adgrb1 A G 15: 74,539,775 T376A probably damaging Het
Atp5o CTTTGACG C 16: 91,926,916 probably null Het
Atp5o TTTGACGGT TT 16: 91,926,917 probably null Het
Car9 A G 4: 43,507,180 E42G probably benign Het
Cep41 T C 6: 30,680,346 K9R probably null Het
Ckm A G 7: 19,415,473 T141A probably benign Het
Clcc1 G T 3: 108,674,660 R360S probably benign Het
Clcn3 A C 8: 60,937,469 I146R probably damaging Het
Crlf1 A G 8: 70,498,816 D115G probably damaging Het
Dnah1 T A 14: 31,266,013 I3483F probably damaging Het
Dopey1 T C 9: 86,524,588 *386Q probably null Het
Eftud2 A G 11: 102,839,436 V899A probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Faap100 A G 11: 120,376,862 S362P probably damaging Het
Fdps A T 3: 89,099,348 D78E probably benign Het
Fsd1l T G 4: 53,694,760 W405G probably damaging Het
Fsd1l T C 4: 53,701,093 V485A possibly damaging Het
Gm12887 C T 4: 121,616,504 V50M probably benign Het
Gm16486 G A 8: 70,708,704 G182D probably damaging Het
Gm45785 T C 7: 140,818,703 I94V unknown Het
Gm8251 A G 1: 44,057,360 V1526A probably benign Het
Hcls1 C T 16: 36,956,638 A230V probably benign Het
Hmcn1 A C 1: 150,646,592 V3519G probably benign Het
Hmgcs1 A G 13: 119,704,427 Y360C probably benign Het
Hsd17b13 A G 5: 103,965,773 probably null Het
Ift57 T A 16: 49,736,722 D235E possibly damaging Het
Iltifb A G 10: 118,294,233 C89R probably damaging Het
Krt9 T A 11: 100,188,721 Y615F unknown Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Marco T C 1: 120,494,085 E130G probably damaging Het
Ms4a18 A T 19: 11,011,440 L184Q probably damaging Het
Mtus1 A T 8: 41,082,886 S598T probably damaging Het
Nbeal2 C A 9: 110,634,368 R1265L probably damaging Het
Odf2 G T 2: 29,926,803 G754C probably benign Het
Olfr1131 T C 2: 87,628,732 S90P probably benign Het
Olfr1274-ps C A 2: 90,401,573 T304K probably benign Het
Olfr164 T G 16: 19,286,350 Y131S probably benign Het
Olfr810 A T 10: 129,790,920 I223N probably damaging Het
Paqr8 G A 1: 20,934,904 W94* probably null Het
Pkd1 G A 17: 24,594,958 G4132D probably damaging Het
Pom121l2 A G 13: 21,984,336 M926V probably benign Het
Postn A T 3: 54,365,915 Y79F probably damaging Het
Prl7d1 T C 13: 27,709,199 E242G probably benign Het
Rcor3 G T 1: 192,125,881 H165Q possibly damaging Het
Rnf157 A G 11: 116,359,892 V161A probably damaging Het
Rnf38 G A 4: 44,143,584 T150M probably damaging Het
Scn4b T A 9: 45,146,715 V35E probably damaging Het
Serpina3i T C 12: 104,265,413 I103T probably damaging Het
Shcbp1 T A 8: 4,744,518 D425V probably damaging Het
Sidt2 T C 9: 45,941,360 T776A possibly damaging Het
Siglecg A G 7: 43,412,432 D534G probably benign Het
Sipa1l3 T A 7: 29,378,014 T778S probably benign Het
Slc13a1 A G 6: 24,108,204 V291A probably benign Het
Stra6l A G 4: 45,881,454 I439V probably benign Het
Tdrd7 G A 4: 46,005,319 S375N probably benign Het
Vmn1r192 T A 13: 22,188,021 I10L probably benign Het
Vmn2r34 T G 7: 7,683,818 L293F possibly damaging Het
Xirp2 G T 2: 67,516,978 A3188S probably damaging Het
Zcchc6 A T 13: 59,799,984 M841K probably benign Het
Zfp219 A G 14: 52,008,743 V309A probably damaging Het
Zfp341 C A 2: 154,627,987 P197T probably damaging Het
Zfp628 G A 7: 4,919,550 R257H probably benign Het
Zfp644 T G 5: 106,636,458 Y741S probably benign Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
basin UTSW 17 24318185 missense probably benign 0.01
Bowl UTSW 17 24317238 missense probably benign 0.09
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8517:Abca17 UTSW 17 24317233 missense probably benign 0.00
R8811:Abca17 UTSW 17 24317238 missense probably benign 0.09
R8819:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8820:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8953:Abca17 UTSW 17 24299041 missense probably benign
R9095:Abca17 UTSW 17 24281396 missense probably damaging 0.97
R9314:Abca17 UTSW 17 24328619 missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24264505 missense probably benign
R9351:Abca17 UTSW 17 24291777 missense probably benign 0.00
R9387:Abca17 UTSW 17 24334281 missense probably benign 0.02
R9388:Abca17 UTSW 17 24264299 missense unknown
R9440:Abca17 UTSW 17 24280478 missense probably benign 0.02
RF024:Abca17 UTSW 17 24287732 frame shift probably null
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCGTACTCACATTCACGAG -3'
(R):5'- GTACACTTGCTAGGTAGATGGTTACAC -3'

Sequencing Primer
(F):5'- GATAGAAATGCCCACCCTA -3'
(R):5'- CTGTTAACACAGCTGTTGTTTCTG -3'
Posted On 2022-03-25