Incidental Mutation 'R9314:Anapc1'
ID 705758
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Name anaphase promoting complex subunit 1
Synonyms 2610021O03Rik, tsg24, Apc1, Mcpr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9314 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128610104-128687391 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 128622500 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 1692 (S1692L)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499]
AlphaFold P53995
Predicted Effect possibly damaging
Transcript: ENSMUST00000014499
AA Change: S1692L

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: S1692L

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A C 17: 24,328,619 N260K possibly damaging Het
Brca2 A G 5: 150,550,894 R2421G probably damaging Het
Cad A G 5: 31,077,644 Y2143C probably damaging Het
Calr3 T A 8: 72,424,691 D356V possibly damaging Het
Cd207 T A 6: 83,675,717 T144S probably damaging Het
Cntln T C 4: 85,006,482 L608P probably damaging Het
Dnah8 A T 17: 30,771,883 Y3300F probably benign Het
Emb T C 13: 117,272,068 I315T probably damaging Het
Esr1 T A 10: 4,966,181 V456E possibly damaging Het
Evpl A T 11: 116,227,677 H701Q probably benign Het
F5 C T 1: 164,201,577 T1715I probably benign Het
Fut10 T A 8: 31,201,476 H116Q probably damaging Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,710 probably benign Het
Gm5591 T C 7: 38,522,460 T62A probably benign Het
Hectd4 T C 5: 121,299,645 probably null Het
Ifit1bl1 G C 19: 34,599,293 Q3E probably benign Het
Ighg3 A T 12: 113,360,326 D147E Het
Ighv8-13 A G 12: 115,765,376 V87A possibly damaging Het
Kdelr1 A G 7: 45,881,626 T160A probably benign Het
Kdm2a A G 19: 4,322,482 L945P probably damaging Het
Krt36 C T 11: 100,103,401 W283* probably null Het
Lamp3 T C 16: 19,673,442 M351V probably benign Het
Lox C G 18: 52,520,839 R395P probably damaging Het
Lrrtm3 T C 10: 64,089,720 probably benign Het
Madcam1 C A 10: 79,665,647 T182K probably damaging Het
Megf8 T A 7: 25,329,872 H280Q probably damaging Het
Mrgprb5 A G 7: 48,168,426 I187T probably benign Het
Muc1 T C 3: 89,231,518 V478A probably damaging Het
Mug1 T G 6: 121,857,337 V359G probably damaging Het
Myh4 A G 11: 67,260,315 H1932R probably benign Het
Naaladl1 A C 19: 6,112,371 N448H probably damaging Het
Olfr690 A T 7: 105,329,874 I106N probably damaging Het
Olfr76 C T 19: 12,119,780 E311K probably benign Het
Pkd1l1 A T 11: 8,879,153 Y1480N Het
Poll T C 19: 45,558,652 E127G probably benign Het
Ppl T C 16: 5,104,503 N305S possibly damaging Het
Prss53 A G 7: 127,890,867 V17A probably benign Het
Ptprj A G 2: 90,471,287 V74A possibly damaging Het
Rapgef4 A T 2: 72,234,639 H804L possibly damaging Het
Rassf8 A G 6: 145,816,570 T356A probably damaging Het
Rptor T C 11: 119,895,946 S1246P probably benign Het
Setdb2 A T 14: 59,412,791 I458N probably benign Het
Sgtb A G 13: 104,118,425 K68E possibly damaging Het
Slc19a3 T G 1: 83,022,373 I308L possibly damaging Het
Slc22a5 T C 11: 53,871,661 D320G possibly damaging Het
Slc34a2 T C 5: 53,060,801 S141P possibly damaging Het
Slc37a2 T C 9: 37,239,186 T158A possibly damaging Het
Slc7a1 T C 5: 148,332,517 I598V probably benign Het
Sphk2 T C 7: 45,711,734 D282G probably damaging Het
Spty2d1 G T 7: 46,998,738 P148T probably damaging Het
Supt3 A G 17: 45,041,363 T310A probably benign Het
Supt5 T A 7: 28,320,374 D457V probably damaging Het
Svep1 C T 4: 58,070,347 G2480R probably damaging Het
Tbcd T C 11: 121,596,471 V803A probably benign Het
Tex2 A T 11: 106,544,249 C784S unknown Het
Thrb A G 14: 17,963,208 H57R probably benign Het
Tmc4 T C 7: 3,676,724 T34A possibly damaging Het
Tmprss2 T C 16: 97,599,259 N4S probably benign Het
Trank1 A G 9: 111,365,981 I1024M probably damaging Het
Trnau1ap C A 4: 132,329,386 probably benign Het
Ttn A G 2: 76,736,366 V28061A probably damaging Het
Txnl4b C A 8: 109,572,699 P97Q probably benign Het
Ube4a T C 9: 44,942,725 T573A probably benign Het
Vit A T 17: 78,619,615 T330S probably benign Het
Wdr3 T C 3: 100,142,972 I750V probably benign Het
Zfp59 C T 7: 27,854,604 L494F possibly damaging Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 splice site probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128674593 missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
R8402:Anapc1 UTSW 2 128630228 missense probably benign 0.02
R8422:Anapc1 UTSW 2 128675837 missense probably benign
R8425:Anapc1 UTSW 2 128669868 missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128658344 splice site probably null
R8553:Anapc1 UTSW 2 128619913 missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128685828 missense probably benign 0.19
R8699:Anapc1 UTSW 2 128641453 missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128641449 missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128622413 missense possibly damaging 0.67
R8973:Anapc1 UTSW 2 128664032 missense probably damaging 0.99
R8977:Anapc1 UTSW 2 128641402 missense probably damaging 1.00
R9000:Anapc1 UTSW 2 128634708 missense probably damaging 1.00
R9080:Anapc1 UTSW 2 128622506 missense possibly damaging 0.82
R9203:Anapc1 UTSW 2 128623502 missense possibly damaging 0.66
R9386:Anapc1 UTSW 2 128617722 missense probably benign 0.08
R9415:Anapc1 UTSW 2 128634678 missense probably benign
R9436:Anapc1 UTSW 2 128676125 missense probably benign
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAAACCACGGTCCATTCAGC -3'
(R):5'- AGGTCATGAATCTGGACATCAC -3'

Sequencing Primer
(F):5'- GAAACCACGGTCCATTCAGCTTTAC -3'
(R):5'- TCATGAATCTGGACATCACAGAAAAG -3'
Posted On 2022-03-25