Mutagenetix > Incidental Mutations

Incidental Mutation 'R0738:Tll1'

70578

Institutional Source

Beutler Lab

Gene Symbol

Tll1

Ensembl Gene

ENSMUSG00000053626

Gene Name

tolloid-like

Synonyms

Tll-1

MMRRC Submission

038919-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0738 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64014931-64206271 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64101950 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 233 (D233G)

Ref Sequence

ENSEMBL: ENSMUSP00000070560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066166]

Predicted Effect

probably damaging
Transcript: ENSMUST00000066166
AA Change: D233G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: D233G

Domain	Start	End	E-Value	Type
ZnMc	153	295	4.12e-56	SMART
CUB	349	461	4.12e-44	SMART
CUB	462	574	3.81e-48	SMART
EGF_CA	574	615	2.28e-9	SMART
CUB	618	730	9.11e-46	SMART
EGF_CA	730	770	4.25e-9	SMART
CUB	774	886	2.01e-47	SMART
CUB	887	1003	7.19e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209451

Meta Mutation Damage Score

0.5068

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.6%
20x: 92.3%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930011G23Rik	A	T	5: 99,240,953	M189K	probably benign	Het
Ank1	A	T	8: 23,114,114	E964D	probably damaging	Het
Ankhd1	A	G	18: 36,645,249		probably benign	Het
Cd9	G	T	6: 125,462,140	Q169K	probably benign	Het
Cdc42bpa	T	A	1: 179,999,462		probably benign	Het
Ch25h	T	C	19: 34,474,387	N247S	possibly damaging	Het
Dctn1	T	C	6: 83,190,107		probably null	Het
Defa22	C	T	8: 21,162,375	T19I	probably benign	Het
Dscam	T	C	16: 96,819,781	N576D	possibly damaging	Het
Epha3	T	C	16: 63,595,612	M675V	probably damaging	Het
Fam241a	C	A	3: 127,870,793	A120S	possibly damaging	Het
Fkbp8	T	A	8: 70,529,670	I86N	probably damaging	Het
Herc4	C	T	10: 63,289,149	P514L	possibly damaging	Het
Ide	A	T	19: 37,277,965	L813*	probably null	Het
Igkv12-41	G	A	6: 69,858,691	Q26*	probably null	Het
Itsn2	T	C	12: 4,635,681	V483A	probably benign	Het
Kcp	A	T	6: 29,490,439	I1002N	probably benign	Het
Lrfn5	G	T	12: 61,840,592	E389*	probably null	Het
Lrp6	G	T	6: 134,542,045	A19E	probably benign	Het
Mad1l1	A	G	5: 140,300,560	L228P	probably damaging	Het
Map2	T	C	1: 66,425,189		probably benign	Het
Med13l	T	A	5: 118,751,633	Y1820N	probably damaging	Het
Mgam	A	G	6: 40,754,935	N735S	probably benign	Het
Mid2	A	G	X: 140,763,676	Y618C	probably damaging	Het
Mllt11	G	A	3: 95,220,286	Q58*	probably null	Het
Mttp	A	G	3: 138,103,313	V678A	probably damaging	Het
Nfatc1	A	G	18: 80,697,910	S278P	probably damaging	Het
Ninj2	A	G	6: 120,198,137		probably benign	Het
Nsd3	T	A	8: 25,678,709		probably null	Het
Olfr1454	A	T	19: 13,063,738	E109V	probably damaging	Het
Olfr895	T	C	9: 38,269,125	V204A	possibly damaging	Het
Pcdhb4	A	G	18: 37,308,711	N358S	probably damaging	Het
Plch1	T	C	3: 63,702,553		probably benign	Het
Popdc3	T	C	10: 45,315,258	L155P	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm26	A	T	14: 105,176,782	I24N	unknown	Het
Rc3h2	T	A	2: 37,405,374	D210V	probably damaging	Het
Samd1	CGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	8: 83,998,996		probably benign	Het
Spopl	T	C	2: 23,537,521	T200A	probably benign	Het
Tarbp1	A	G	8: 126,438,801		probably null	Het
Thnsl1	T	A	2: 21,213,362	H121Q	probably damaging	Het
Vmn2r27	A	T	6: 124,223,702	V432E	possibly damaging	Het
Wdr5	T	C	2: 27,519,412	S49P	probably damaging	Het
Zfyve26	A	T	12: 79,295,534	I46N	probably damaging	Het

Other mutations in Tll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tll1	APN	8	64016136	missense	probably benign
IGL00583:Tll1	APN	8	64205292	missense	probably benign
IGL00767:Tll1	APN	8	64071321	missense	probably damaging	1.00
IGL01061:Tll1	APN	8	64038454	critical splice donor site	probably null
IGL01077:Tll1	APN	8	64070232	missense	probably benign	0.27
IGL01536:Tll1	APN	8	64074289	missense	probably damaging	1.00
IGL02137:Tll1	APN	8	64016098	missense	possibly damaging	0.73
IGL02168:Tll1	APN	8	64053967	missense	possibly damaging	0.50
IGL02378:Tll1	APN	8	64017626	nonsense	probably null
IGL02469:Tll1	APN	8	64070280	missense	probably benign	0.41
IGL02504:Tll1	APN	8	64070237	missense	possibly damaging	0.55
IGL02650:Tll1	APN	8	64046997	splice site	probably benign
IGL02937:Tll1	APN	8	64205285	nonsense	probably null
IGL03006:Tll1	APN	8	64074217	splice site	probably benign
R0518:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0521:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0541:Tll1	UTSW	8	64038452	splice site	probably null
R0612:Tll1	UTSW	8	64071310	missense	possibly damaging	0.91
R0690:Tll1	UTSW	8	64074290	missense	probably damaging	0.99
R1454:Tll1	UTSW	8	64038490	missense	probably benign
R1619:Tll1	UTSW	8	64056273	missense	probably benign	0.25
R1625:Tll1	UTSW	8	64041442	missense	probably damaging	1.00
R1654:Tll1	UTSW	8	64117903	critical splice donor site	probably null
R1663:Tll1	UTSW	8	64017686	missense	probably benign	0.08
R1681:Tll1	UTSW	8	64085551	missense	possibly damaging	0.93
R1713:Tll1	UTSW	8	64101873	missense	probably damaging	0.99
R1908:Tll1	UTSW	8	64025107	missense	probably damaging	0.98
R2118:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2121:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2124:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2360:Tll1	UTSW	8	64051401	missense	probably damaging	1.00
R2396:Tll1	UTSW	8	64070290	nonsense	probably null
R3032:Tll1	UTSW	8	64098492	missense	probably damaging	0.96
R3115:Tll1	UTSW	8	64053866	missense	probably damaging	1.00
R3889:Tll1	UTSW	8	64205224	missense	possibly damaging	0.77
R4126:Tll1	UTSW	8	64118014	missense	possibly damaging	0.78
R4182:Tll1	UTSW	8	64041511	missense	probably damaging	1.00
R4572:Tll1	UTSW	8	64056309	missense	possibly damaging	0.81
R4677:Tll1	UTSW	8	64051377	missense	probably benign	0.31
R4811:Tll1	UTSW	8	64085473	missense	possibly damaging	0.72
R4904:Tll1	UTSW	8	64070199	missense	probably benign	0.00
R4992:Tll1	UTSW	8	64093944	missense	probably damaging	0.98
R5061:Tll1	UTSW	8	64053949	missense	probably damaging	0.99
R5078:Tll1	UTSW	8	64093887	missense	probably damaging	1.00
R5208:Tll1	UTSW	8	64051493	missense	probably damaging	0.99
R5283:Tll1	UTSW	8	64101966	missense	possibly damaging	0.68
R5399:Tll1	UTSW	8	64085488	missense	probably damaging	1.00
R5699:Tll1	UTSW	8	64117940	missense	probably damaging	0.98
R5986:Tll1	UTSW	8	64074263	missense	probably damaging	0.99
R6019:Tll1	UTSW	8	64041491	missense	possibly damaging	0.83
R6046:Tll1	UTSW	8	64053891	nonsense	probably null
R6083:Tll1	UTSW	8	64038586	splice site	probably null
R6125:Tll1	UTSW	8	64051487	missense	probably damaging	1.00
R6222:Tll1	UTSW	8	64098534	missense	probably benign	0.18
R6275:Tll1	UTSW	8	64051367	nonsense	probably null
R6508:Tll1	UTSW	8	64098460	missense	probably damaging	0.99
R6758:Tll1	UTSW	8	64041405	critical splice donor site	probably null
R6782:Tll1	UTSW	8	64071281	missense	probably benign	0.00
R6848:Tll1	UTSW	8	64098510	missense	probably damaging	0.99
R7057:Tll1	UTSW	8	64101881	missense	probably damaging	1.00
R7144:Tll1	UTSW	8	64124945	missense	possibly damaging	0.90
R7244:Tll1	UTSW	8	64025188	missense	probably benign	0.00
R7336:Tll1	UTSW	8	64025142	missense	probably damaging	0.98
R7373:Tll1	UTSW	8	64051357	missense	probably damaging	0.98
R7626:Tll1	UTSW	8	64098234	splice site	probably null
R7687:Tll1	UTSW	8	64121492	nonsense	probably null
R7699:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7700:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7765:Tll1	UTSW	8	64051449	missense	probably damaging	1.00
R7790:Tll1	UTSW	8	64025237	nonsense	probably null
R7954:Tll1	UTSW	8	64118534	missense	probably damaging	1.00
X0020:Tll1	UTSW	8	64017628	missense	probably damaging	0.97
Z1176:Tll1	UTSW	8	64047163	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCAGTGCAGATCTCAGACCCCTT -3'
(R):5'- GACTGACTATCCCTTTCAACAGCACAT -3'

Sequencing Primer
(F):5'- GCAGATCTCAGACCCCTTTAAGTC -3'
(R):5'- CTGACTCAGGATATGCTGTGCTATAC -3'

Posted On

2013-09-30