Incidental Mutation 'R0738:Fkbp8'
ID70579
Institutional Source Beutler Lab
Gene Symbol Fkbp8
Ensembl Gene ENSMUSG00000019428
Gene NameFK506 binding protein 8
Synonyms38kDa, Fkbp38
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70527724-70535328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70529670 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 86 (I86N)
Ref Sequence ENSEMBL: ENSMUSP00000114069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075491] [ENSMUST00000117580] [ENSMUST00000119353] [ENSMUST00000119425] [ENSMUST00000119698] [ENSMUST00000132867] [ENSMUST00000134893] [ENSMUST00000138260]
Predicted Effect probably damaging
Transcript: ENSMUST00000075491
AA Change: I86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074935
Gene: ENSMUSG00000019428
AA Change: I86N

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 192 1.4e-16 PFAM
Blast:TPR 212 245 2e-12 BLAST
low complexity region 253 259 N/A INTRINSIC
Pfam:TPR_1 263 296 5.4e-7 PFAM
Pfam:TPR_2 263 296 3.8e-5 PFAM
Pfam:TPR_16 267 331 3e-11 PFAM
Pfam:TPR_9 270 344 1.3e-7 PFAM
Pfam:TPR_19 273 340 1.6e-8 PFAM
Pfam:TPR_1 297 330 5.4e-8 PFAM
Pfam:TPR_2 297 330 1.3e-7 PFAM
Pfam:TPR_8 297 330 9e-7 PFAM
Pfam:TPR_14 297 340 2.1e-7 PFAM
transmembrane domain 381 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117580
SMART Domains Protein: ENSMUSP00000112561
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 5.1e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119353
AA Change: I86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112527
Gene: ENSMUSG00000019428
AA Change: I86N

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 191 1.3e-15 PFAM
Pfam:TPR_11 209 293 3.4e-9 PFAM
Pfam:TPR_1 262 295 6.5e-7 PFAM
Pfam:TPR_2 262 295 3.9e-5 PFAM
Pfam:TPR_16 266 330 1.4e-11 PFAM
Pfam:TPR_9 269 343 1.5e-7 PFAM
Pfam:TPR_19 272 339 8.6e-9 PFAM
Pfam:TPR_11 294 358 2.6e-9 PFAM
Pfam:TPR_1 296 329 6.6e-8 PFAM
Pfam:TPR_2 296 329 1.3e-7 PFAM
Pfam:TPR_8 296 330 5.5e-7 PFAM
transmembrane domain 380 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119425
SMART Domains Protein: ENSMUSP00000113528
Gene: ENSMUSG00000019428

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119698
AA Change: I86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114069
Gene: ENSMUSG00000019428
AA Change: I86N

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 192 6.4e-16 PFAM
Pfam:TPR_11 210 294 3.4e-9 PFAM
Pfam:TPR_1 263 296 6.5e-7 PFAM
Pfam:TPR_2 263 296 3.9e-5 PFAM
Pfam:TPR_16 267 331 1.4e-11 PFAM
Pfam:TPR_9 270 344 1.5e-7 PFAM
Pfam:TPR_19 273 340 8.6e-9 PFAM
Pfam:TPR_11 295 359 2.6e-9 PFAM
Pfam:TPR_1 297 330 6.6e-8 PFAM
Pfam:TPR_2 297 330 1.3e-7 PFAM
Pfam:TPR_8 297 331 5.6e-7 PFAM
transmembrane domain 381 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128513
Predicted Effect probably benign
Transcript: ENSMUST00000132867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144766
Predicted Effect probably benign
Transcript: ENSMUST00000134893
Predicted Effect probably benign
Transcript: ENSMUST00000138260
SMART Domains Protein: ENSMUSP00000123438
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 9.2e-40 PFAM
UBQ 105 176 2.14e-36 SMART
Meta Mutation Damage Score 0.2794 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, ventralization of neural cell fates, caudal neural tube dilation, and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Fkbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Fkbp8 APN 8 70534561 missense probably damaging 1.00
IGL01832:Fkbp8 APN 8 70531545 missense probably benign 0.24
R1631:Fkbp8 UTSW 8 70531632 missense probably damaging 1.00
R1845:Fkbp8 UTSW 8 70531035 splice site probably null
R3951:Fkbp8 UTSW 8 70532661 missense probably damaging 1.00
R3953:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R3956:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R3957:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R4965:Fkbp8 UTSW 8 70531523 critical splice acceptor site probably null
R6655:Fkbp8 UTSW 8 70532670 missense probably damaging 1.00
R7081:Fkbp8 UTSW 8 70530994 missense probably benign 0.05
R8454:Fkbp8 UTSW 8 70531763 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGGGTTATCACTGTCACACTTGCC -3'
(R):5'- TCTCTGAGCTGCTGTTACCAGCAC -3'

Sequencing Primer
(F):5'- AGTTCCTGATCCCAGCAGC -3'
(R):5'- gcagacccagcttggac -3'
Posted On2013-09-30