Incidental Mutation 'R9314:Abca17'
ID 705810
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9314 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 24264259-24351029 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 24328619 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 260 (N260K)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect possibly damaging
Transcript: ENSMUST00000039324
AA Change: N260K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: N260K

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121226
AA Change: N260K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: N260K

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 G A 2: 128,622,500 S1692L possibly damaging Het
Brca2 A G 5: 150,550,894 R2421G probably damaging Het
Cad A G 5: 31,077,644 Y2143C probably damaging Het
Calr3 T A 8: 72,424,691 D356V possibly damaging Het
Cd207 T A 6: 83,675,717 T144S probably damaging Het
Cntln T C 4: 85,006,482 L608P probably damaging Het
Dnah8 A T 17: 30,771,883 Y3300F probably benign Het
Emb T C 13: 117,272,068 I315T probably damaging Het
Esr1 T A 10: 4,966,181 V456E possibly damaging Het
Evpl A T 11: 116,227,677 H701Q probably benign Het
F5 C T 1: 164,201,577 T1715I probably benign Het
Fut10 T A 8: 31,201,476 H116Q probably damaging Het
Gm40460 ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,710 probably benign Het
Gm5591 T C 7: 38,522,460 T62A probably benign Het
Hectd4 T C 5: 121,299,645 probably null Het
Ifit1bl1 G C 19: 34,599,293 Q3E probably benign Het
Ighg3 A T 12: 113,360,326 D147E Het
Ighv8-13 A G 12: 115,765,376 V87A possibly damaging Het
Kdelr1 A G 7: 45,881,626 T160A probably benign Het
Kdm2a A G 19: 4,322,482 L945P probably damaging Het
Krt36 C T 11: 100,103,401 W283* probably null Het
Lamp3 T C 16: 19,673,442 M351V probably benign Het
Lox C G 18: 52,520,839 R395P probably damaging Het
Lrrtm3 T C 10: 64,089,720 probably benign Het
Madcam1 C A 10: 79,665,647 T182K probably damaging Het
Megf8 T A 7: 25,329,872 H280Q probably damaging Het
Mrgprb5 A G 7: 48,168,426 I187T probably benign Het
Muc1 T C 3: 89,231,518 V478A probably damaging Het
Mug1 T G 6: 121,857,337 V359G probably damaging Het
Myh4 A G 11: 67,260,315 H1932R probably benign Het
Naaladl1 A C 19: 6,112,371 N448H probably damaging Het
Olfr690 A T 7: 105,329,874 I106N probably damaging Het
Olfr76 C T 19: 12,119,780 E311K probably benign Het
Pkd1l1 A T 11: 8,879,153 Y1480N Het
Poll T C 19: 45,558,652 E127G probably benign Het
Ppl T C 16: 5,104,503 N305S possibly damaging Het
Prss53 A G 7: 127,890,867 V17A probably benign Het
Ptprj A G 2: 90,471,287 V74A possibly damaging Het
Rapgef4 A T 2: 72,234,639 H804L possibly damaging Het
Rassf8 A G 6: 145,816,570 T356A probably damaging Het
Rptor T C 11: 119,895,946 S1246P probably benign Het
Setdb2 A T 14: 59,412,791 I458N probably benign Het
Sgtb A G 13: 104,118,425 K68E possibly damaging Het
Slc19a3 T G 1: 83,022,373 I308L possibly damaging Het
Slc22a5 T C 11: 53,871,661 D320G possibly damaging Het
Slc34a2 T C 5: 53,060,801 S141P possibly damaging Het
Slc37a2 T C 9: 37,239,186 T158A possibly damaging Het
Slc7a1 T C 5: 148,332,517 I598V probably benign Het
Sphk2 T C 7: 45,711,734 D282G probably damaging Het
Spty2d1 G T 7: 46,998,738 P148T probably damaging Het
Supt3 A G 17: 45,041,363 T310A probably benign Het
Supt5 T A 7: 28,320,374 D457V probably damaging Het
Svep1 C T 4: 58,070,347 G2480R probably damaging Het
Tbcd T C 11: 121,596,471 V803A probably benign Het
Tex2 A T 11: 106,544,249 C784S unknown Het
Thrb A G 14: 17,963,208 H57R probably benign Het
Tmc4 T C 7: 3,676,724 T34A possibly damaging Het
Tmprss2 T C 16: 97,599,259 N4S probably benign Het
Trank1 A G 9: 111,365,981 I1024M probably damaging Het
Trnau1ap C A 4: 132,329,386 probably benign Het
Ttn A G 2: 76,736,366 V28061A probably damaging Het
Txnl4b C A 8: 109,572,699 P97Q probably benign Het
Ube4a T C 9: 44,942,725 T573A probably benign Het
Vit A T 17: 78,619,615 T330S probably benign Het
Wdr3 T C 3: 100,142,972 I750V probably benign Het
Zfp59 C T 7: 27,854,604 L494F possibly damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
basin UTSW 17 24318185 missense probably benign 0.01
Bowl UTSW 17 24317238 missense probably benign 0.09
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8517:Abca17 UTSW 17 24317233 missense probably benign 0.00
R8811:Abca17 UTSW 17 24317238 missense probably benign 0.09
R8819:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8820:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8953:Abca17 UTSW 17 24299041 missense probably benign
R9095:Abca17 UTSW 17 24281396 missense probably damaging 0.97
R9313:Abca17 UTSW 17 24346233 missense probably benign 0.00
R9347:Abca17 UTSW 17 24264505 missense probably benign
R9351:Abca17 UTSW 17 24291777 missense probably benign 0.00
R9387:Abca17 UTSW 17 24334281 missense probably benign 0.02
R9388:Abca17 UTSW 17 24264299 missense unknown
R9440:Abca17 UTSW 17 24280478 missense probably benign 0.02
RF024:Abca17 UTSW 17 24287732 frame shift probably null
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGGTACTCCCTCCTACAGATAAG -3'
(R):5'- GGCTACAACAAAGAAGGCTTC -3'

Sequencing Primer
(F):5'- TCCCTCCTACAGATAAGAAAGTGTTC -3'
(R):5'- GCTTCCTGGCCATACAGCATG -3'
Posted On 2022-03-25