Incidental Mutation 'R0738:Olfr895'
ID70582
Institutional Source Beutler Lab
Gene Symbol Olfr895
Ensembl Gene ENSMUSG00000096427
Gene Nameolfactory receptor 895
SynonymsMOR170-1, GA_x6K02T2PVTD-31962461-31963411
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38267851-38269735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38269125 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 204 (V204A)
Ref Sequence ENSEMBL: ENSMUSP00000091387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093864] [ENSMUST00000212156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093864
AA Change: V204A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091387
Gene: ENSMUSG00000096427
AA Change: V204A

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 4.6e-47 PFAM
Pfam:7tm_1 47 246 3.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212156
AA Change: V196A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Olfr895
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Olfr895 APN 9 38268505 splice site probably benign
IGL01477:Olfr895 APN 9 38269319 missense possibly damaging 0.74
IGL02150:Olfr895 APN 9 38269268 missense possibly damaging 0.56
R0616:Olfr895 UTSW 9 38269334 missense probably benign 0.08
R3155:Olfr895 UTSW 9 38268540 start codon destroyed probably null 0.98
R3824:Olfr895 UTSW 9 38268518 missense probably benign
R3825:Olfr895 UTSW 9 38268518 missense probably benign
R4023:Olfr895 UTSW 9 38269461 missense possibly damaging 0.83
R4687:Olfr895 UTSW 9 38269414 missense probably damaging 1.00
R4692:Olfr895 UTSW 9 38268530 nonsense probably null
R6171:Olfr895 UTSW 9 38268602 nonsense probably null
R6736:Olfr895 UTSW 9 38268570 missense probably damaging 1.00
R6950:Olfr895 UTSW 9 38268546 missense probably damaging 1.00
R7256:Olfr895 UTSW 9 38268708 missense probably damaging 0.98
R7774:Olfr895 UTSW 9 38269359 missense probably damaging 0.99
R7937:Olfr895 UTSW 9 38269048 missense probably benign 0.16
R8354:Olfr895 UTSW 9 38269217 missense probably benign 0.02
Z1088:Olfr895 UTSW 9 38268612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGCAATGGCCTATGATCGC -3'
(R):5'- GGCTTGACATAAGCAAGCATCCCAG -3'

Sequencing Primer
(F):5'- CAAAGCTGTTATGTCACCTGG -3'
(R):5'- TAAGCAAGCATCCCAGTTACATAG -3'
Posted On2013-09-30