Incidental Mutation 'R0738:Popdc3'
ID70583
Institutional Source Beutler Lab
Gene Symbol Popdc3
Ensembl Gene ENSMUSG00000019848
Gene Namepopeye domain containing 3
SynonymsPop3
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location45178098-45318452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45315258 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 155 (L155P)
Ref Sequence ENSEMBL: ENSMUSP00000019994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019994] [ENSMUST00000161803] [ENSMUST00000175658]
Predicted Effect probably damaging
Transcript: ENSMUST00000019994
AA Change: L155P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019994
Gene: ENSMUSG00000019848
AA Change: L155P

DomainStartEndE-ValueType
Pfam:Popeye 25 249 1.8e-94 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161803
AA Change: L155P
SMART Domains Protein: ENSMUSP00000125532
Gene: ENSMUSG00000019848
AA Change: L155P

DomainStartEndE-ValueType
transmembrane domain 27 44 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
Pfam:Popeye 107 169 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175658
SMART Domains Protein: ENSMUSP00000135373
Gene: ENSMUSG00000019848

DomainStartEndE-ValueType
transmembrane domain 27 44 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
Meta Mutation Damage Score 0.9633 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in these tissues during development. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Popdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Popdc3 APN 10 45317826 splice site probably null
IGL01304:Popdc3 APN 10 45317909 missense probably benign
IGL01643:Popdc3 APN 10 45314880 missense probably damaging 1.00
IGL02755:Popdc3 APN 10 45315218 missense probably damaging 1.00
R0410:Popdc3 UTSW 10 45317733 missense possibly damaging 0.95
R0586:Popdc3 UTSW 10 45315263 missense probably benign 0.04
R1102:Popdc3 UTSW 10 45316546 unclassified probably benign
R1649:Popdc3 UTSW 10 45315224 missense probably damaging 1.00
R2026:Popdc3 UTSW 10 45314855 missense probably damaging 1.00
R4720:Popdc3 UTSW 10 45314906 missense probably benign 0.04
R5669:Popdc3 UTSW 10 45316433 missense probably damaging 1.00
R5905:Popdc3 UTSW 10 45317919 missense probably benign
R6028:Popdc3 UTSW 10 45317919 missense probably benign
R7468:Popdc3 UTSW 10 45315021 missense probably damaging 1.00
R7693:Popdc3 UTSW 10 45315131 missense probably benign 0.01
R7864:Popdc3 UTSW 10 45315182 missense probably benign 0.13
X0057:Popdc3 UTSW 10 45315111 missense probably benign 0.10
Z1177:Popdc3 UTSW 10 45314884 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCACAGCATAACCTTCGCCCG -3'
(R):5'- AGATCTACCAGGTCAAGCTGCCTC -3'

Sequencing Primer
(F):5'- TGTACAGCTCGCTCTTCAAG -3'
(R):5'- CAGAACCAAATTCATGCTTTGC -3'
Posted On2013-09-30