Incidental Mutation 'R0738:Zfyve26'
ID70587
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Namezinc finger, FYVE domain containing 26
SynonymsA630028O16Rik, LOC380767, 9330197E15Rik
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location79232346-79296304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79295534 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 46 (I46N)
Ref Sequence ENSEMBL: ENSMUSP00000151280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000079533] [ENSMUST00000171210] [ENSMUST00000218039] [ENSMUST00000218377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021547
AA Change: I46N

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: I46N

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079533
SMART Domains Protein: ENSMUSP00000078490
Gene: ENSMUSG00000059060

DomainStartEndE-ValueType
Pfam:Rad51 61 256 3.1e-32 PFAM
Pfam:AAA_25 68 249 1.1e-15 PFAM
Pfam:KaiC 83 240 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171210
SMART Domains Protein: ENSMUSP00000128357
Gene: ENSMUSG00000059060

DomainStartEndE-ValueType
Pfam:Rad51 61 256 3e-33 PFAM
Pfam:AAA_25 68 241 2.8e-16 PFAM
Pfam:KaiC 83 241 3.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218039
Predicted Effect probably damaging
Transcript: ENSMUST00000218377
AA Change: I46N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219842
Meta Mutation Damage Score 0.1085 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79249460 unclassified probably benign
IGL00940:Zfyve26 APN 12 79280900 missense probably benign
IGL01148:Zfyve26 APN 12 79260870 missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79252183 intron probably null
IGL01472:Zfyve26 APN 12 79276343 missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79244373 missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79287851 missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79261574 splice site probably null
IGL01689:Zfyve26 APN 12 79284053 missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79287444 missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79244400 missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79276395 missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79268847 missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79280080 missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79239020 missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79263870 missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79261791 missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79295564 missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79284072 nonsense probably null
IGL02799:Zfyve26 UTSW 12 79273310 missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79276281 missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79244484 missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79246222 missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79268728 missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79265802 splice site probably benign
R0781:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79273598 missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79272127 missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79263949 missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79274920 missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79282817 missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79252163 missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79252151 missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79287761 missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79238944 missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79278463 missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79269049 missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79286258 missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79264351 missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79239970 nonsense probably null
R1982:Zfyve26 UTSW 12 79255243 missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79284032 splice site probably null
R2071:Zfyve26 UTSW 12 79287446 missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2133:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2135:Zfyve26 UTSW 12 79246052 missense possibly damaging 0.80
R2207:Zfyve26 UTSW 12 79246087 missense probably damaging 0.99
R2280:Zfyve26 UTSW 12 79275040 missense probably damaging 1.00
R2352:Zfyve26 UTSW 12 79284116 missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79282799 splice site probably null
R3084:Zfyve26 UTSW 12 79265683 splice site probably benign
R3086:Zfyve26 UTSW 12 79265683 splice site probably benign
R4626:Zfyve26 UTSW 12 79269070 missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79244396 missense probably benign 0.16
R4908:Zfyve26 UTSW 12 79249695 intron probably null
R4926:Zfyve26 UTSW 12 79275011 missense probably benign
R4990:Zfyve26 UTSW 12 79287833 missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79280385 nonsense probably null
R5029:Zfyve26 UTSW 12 79286323 missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79255361 missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79280058 nonsense probably null
R5252:Zfyve26 UTSW 12 79268982 missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79270850 missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79246521 missense probably damaging 1.00
R5574:Zfyve26 UTSW 12 79239924 missense possibly damaging 0.63
R5735:Zfyve26 UTSW 12 79273373 missense probably damaging 0.96
R5756:Zfyve26 UTSW 12 79264357 missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79287737 missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79266537 missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79293854 missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79268727 missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79249599 missense probably damaging 1.00
R6247:Zfyve26 UTSW 12 79282984 missense probably benign 0.04
R6320:Zfyve26 UTSW 12 79240002 missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79238335 missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79266449 missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79284152 missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79279114 missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79280405 missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79268408 missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79246171 missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79278372 intron probably null
R7299:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79251168 missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79240054 missense probably damaging 1.00
R7466:Zfyve26 UTSW 12 79287807 missense probably benign 0.00
R7540:Zfyve26 UTSW 12 79268676 missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79290957 missense probably damaging 0.97
R7762:Zfyve26 UTSW 12 79268635 missense probably benign 0.02
R7806:Zfyve26 UTSW 12 79280355 critical splice donor site probably null
R7821:Zfyve26 UTSW 12 79255324 missense probably damaging 1.00
RF010:Zfyve26 UTSW 12 79255338 missense probably damaging 1.00
X0020:Zfyve26 UTSW 12 79239005 missense probably damaging 1.00
Z1176:Zfyve26 UTSW 12 79268533 missense probably benign 0.07
Z1177:Zfyve26 UTSW 12 79287375 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGAGCAACACCATCATCAGTC -3'
(R):5'- CCTGCACTCTGTGCTGGGAAAATG -3'

Sequencing Primer
(F):5'- tcgggagtcagaggcag -3'
(R):5'- GCTGGGAAAATGAGTTACCCATTTG -3'
Posted On2013-09-30