Incidental Mutation 'R9316:Ccdc36'
ID 705885
Institutional Source Beutler Lab
Gene Symbol Ccdc36
Ensembl Gene ENSMUSG00000047220
Gene Name coiled-coil domain containing 36
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R9316 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108403611-108428484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108421527 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 31 (T31A)
Ref Sequence ENSEMBL: ENSMUSP00000075898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076592]
AlphaFold Q6PDM4
Predicted Effect possibly damaging
Transcript: ENSMUST00000076592
AA Change: T31A

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075898
Gene: ENSMUSG00000047220
AA Change: T31A

DomainStartEndE-ValueType
Pfam:DUF4700 19 572 4.7e-274 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 91% (32/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr5 C A 2: 158,635,354 N408K probably benign Het
AI661453 A G 17: 47,436,907 I35V probably benign Het
Asb10 G T 5: 24,540,047 N101K possibly damaging Het
Bpifa6 T C 2: 153,986,463 V163A possibly damaging Het
Dmp1 G T 5: 104,209,901 D36Y probably benign Het
Eef1d T A 15: 75,909,281 probably benign Het
Gcm2 C T 13: 41,105,852 R47H probably damaging Het
Gm7145 A G 1: 117,968,444 N72S probably benign Het
Gpr45 T A 1: 43,032,374 V59E probably damaging Het
Gucy1a1 T C 3: 82,108,943 E246G possibly damaging Het
Hspa12a C T 19: 58,804,647 E369K probably benign Het
Il6st T A 13: 112,502,815 N652K possibly damaging Het
Kdm5a T A 6: 120,405,012 D672E probably damaging Het
Klk6 T C 7: 43,828,488 S95P probably benign Het
Lrrc51 C T 7: 101,913,144 R169H probably damaging Het
Olfr295 T C 7: 86,585,926 V217A probably benign Het
Olfr399 A T 11: 74,054,066 I231N probably damaging Het
Pacsin1 A G 17: 27,705,733 K186E possibly damaging Het
Pate3 C T 9: 35,646,078 C94Y probably damaging Het
Pcdh18 G A 3: 49,754,640 T742M probably damaging Het
Pogz T A 3: 94,877,348 S779T probably damaging Het
Prep A T 10: 45,091,096 K75M probably damaging Het
Qsox2 T G 2: 26,211,072 K475T probably benign Het
Qsox2 T A 2: 26,211,073 K475* probably null Het
Rfng A T 11: 120,784,037 D42E unknown Het
Ripor2 C T 13: 24,721,736 T955M probably benign Het
Ryr1 C T 7: 29,017,962 E4554K unknown Het
Slco1a5 A T 6: 142,250,209 L356H probably damaging Het
Tbc1d21 G A 9: 58,366,932 A30V probably benign Het
Tmem161b C A 13: 84,282,736 H158N possibly damaging Het
Tmem217 A G 17: 29,526,409 F116L probably benign Het
Tnfrsf13c A G 15: 82,223,820 I119T probably benign Het
Tpp2 G A 1: 43,978,444 R736H probably damaging Het
Vmn2r75 T A 7: 86,148,105 R833S possibly damaging Het
Zfp330 A G 8: 82,764,858 S229P probably damaging Het
Other mutations in Ccdc36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Ccdc36 APN 9 108417319 splice site probably benign
IGL02138:Ccdc36 APN 9 108406621 missense probably benign 0.00
IGL02305:Ccdc36 APN 9 108405832 missense possibly damaging 0.82
IGL02456:Ccdc36 APN 9 108406621 missense probably benign 0.00
IGL02936:Ccdc36 APN 9 108412503 missense possibly damaging 0.69
IGL03150:Ccdc36 APN 9 108404956 missense probably damaging 0.98
IGL03163:Ccdc36 APN 9 108404933 missense probably benign 0.00
IGL03280:Ccdc36 APN 9 108404900 missense possibly damaging 0.92
R0139:Ccdc36 UTSW 9 108412496 missense probably damaging 1.00
R0276:Ccdc36 UTSW 9 108428440 missense possibly damaging 0.84
R0744:Ccdc36 UTSW 9 108404801 missense probably benign
R0836:Ccdc36 UTSW 9 108404801 missense probably benign
R1792:Ccdc36 UTSW 9 108404912 missense possibly damaging 0.84
R1918:Ccdc36 UTSW 9 108412985 missense probably benign 0.16
R2284:Ccdc36 UTSW 9 108421473 missense probably damaging 1.00
R2401:Ccdc36 UTSW 9 108413006 missense possibly damaging 0.53
R4731:Ccdc36 UTSW 9 108405385 missense probably benign 0.00
R4819:Ccdc36 UTSW 9 108406678 missense probably benign 0.10
R4950:Ccdc36 UTSW 9 108421510 missense probably damaging 1.00
R4968:Ccdc36 UTSW 9 108412514 missense probably benign 0.11
R7131:Ccdc36 UTSW 9 108417420 missense probably benign 0.01
R7201:Ccdc36 UTSW 9 108404775 missense probably damaging 0.98
R7950:Ccdc36 UTSW 9 108405671 missense probably benign
R8778:Ccdc36 UTSW 9 108405608 missense probably damaging 0.97
R9501:Ccdc36 UTSW 9 108405301 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAAGCACAAACCCATTTAGGATAG -3'
(R):5'- GCAGAGCTACATAATAGAGAGCCTATC -3'

Sequencing Primer
(F):5'- CTGTAATTCCAACAATCAGGAGGCTG -3'
(R):5'- AGAGCCTATCTCAAAACGACG -3'
Posted On 2022-03-25