Mutagenetix > Incidental Mutations

Incidental Mutation 'R0738:Ankhd1'

70591

Institutional Source

Beutler Lab

Gene Symbol

Ankhd1

Ensembl Gene

ENSMUSG00000024483

Gene Name

ankyrin repeat and KH domain containing 1

Synonyms

MMRRC Submission

038919-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0738 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36559987-36665917 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 36645249 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000123270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]

Predicted Effect

probably benign
Transcript: ENSMUST00000006205

SMART Domains

Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000037072

SMART Domains

Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
low complexity region	28	47	N/A	INTRINSIC
low complexity region	75	94	N/A	INTRINSIC
KH	183	253	5.04e-13	SMART
low complexity region	458	491	N/A	INTRINSIC
low complexity region	531	547	N/A	INTRINSIC
low complexity region	554	571	N/A	INTRINSIC
low complexity region	824	836	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130035

SMART Domains

Protein: ENSMUSP00000117110
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
ANK	2	26	5.35e2	SMART
ANK	30	59	9.41e-6	SMART
ANK	63	96	3.8e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140061

SMART Domains

Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
low complexity region	54	70	N/A	INTRINSIC
low complexity region	77	94	N/A	INTRINSIC
low complexity region	355	375	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142977

SMART Domains

Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152940

Predicted Effect

probably benign
Transcript: ENSMUST00000153612

SMART Domains

Protein: ENSMUSP00000116462
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
ANK	10	39	9.41e-6	SMART
ANK	43	76	3.8e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155329

SMART Domains

Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2342	2362	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.6%
20x: 92.3%

Validation Efficiency

98% (46/47)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930011G23Rik	A	T	5: 99,240,953	M189K	probably benign	Het
Ank1	A	T	8: 23,114,114	E964D	probably damaging	Het
Cd9	G	T	6: 125,462,140	Q169K	probably benign	Het
Cdc42bpa	T	A	1: 179,999,462		probably benign	Het
Ch25h	T	C	19: 34,474,387	N247S	possibly damaging	Het
Dctn1	T	C	6: 83,190,107		probably null	Het
Defa22	C	T	8: 21,162,375	T19I	probably benign	Het
Dscam	T	C	16: 96,819,781	N576D	possibly damaging	Het
Epha3	T	C	16: 63,595,612	M675V	probably damaging	Het
Fam241a	C	A	3: 127,870,793	A120S	possibly damaging	Het
Fkbp8	T	A	8: 70,529,670	I86N	probably damaging	Het
Herc4	C	T	10: 63,289,149	P514L	possibly damaging	Het
Ide	A	T	19: 37,277,965	L813*	probably null	Het
Igkv12-41	G	A	6: 69,858,691	Q26*	probably null	Het
Itsn2	T	C	12: 4,635,681	V483A	probably benign	Het
Kcp	A	T	6: 29,490,439	I1002N	probably benign	Het
Lrfn5	G	T	12: 61,840,592	E389*	probably null	Het
Lrp6	G	T	6: 134,542,045	A19E	probably benign	Het
Mad1l1	A	G	5: 140,300,560	L228P	probably damaging	Het
Map2	T	C	1: 66,425,189		probably benign	Het
Med13l	T	A	5: 118,751,633	Y1820N	probably damaging	Het
Mgam	A	G	6: 40,754,935	N735S	probably benign	Het
Mid2	A	G	X: 140,763,676	Y618C	probably damaging	Het
Mllt11	G	A	3: 95,220,286	Q58*	probably null	Het
Mttp	A	G	3: 138,103,313	V678A	probably damaging	Het
Nfatc1	A	G	18: 80,697,910	S278P	probably damaging	Het
Ninj2	A	G	6: 120,198,137		probably benign	Het
Nsd3	T	A	8: 25,678,709		probably null	Het
Olfr1454	A	T	19: 13,063,738	E109V	probably damaging	Het
Olfr895	T	C	9: 38,269,125	V204A	possibly damaging	Het
Pcdhb4	A	G	18: 37,308,711	N358S	probably damaging	Het
Plch1	T	C	3: 63,702,553		probably benign	Het
Popdc3	T	C	10: 45,315,258	L155P	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm26	A	T	14: 105,176,782	I24N	unknown	Het
Rc3h2	T	A	2: 37,405,374	D210V	probably damaging	Het
Samd1	CGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	8: 83,998,996		probably benign	Het
Spopl	T	C	2: 23,537,521	T200A	probably benign	Het
Tarbp1	A	G	8: 126,438,801		probably null	Het
Thnsl1	T	A	2: 21,213,362	H121Q	probably damaging	Het
Tll1	T	C	8: 64,101,950	D233G	probably damaging	Het
Vmn2r27	A	T	6: 124,223,702	V432E	possibly damaging	Het
Wdr5	T	C	2: 27,519,412	S49P	probably damaging	Het
Zfyve26	A	T	12: 79,295,534	I46N	probably damaging	Het

Other mutations in Ankhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ankhd1	APN	18	36665459	unclassified	probably benign
IGL00927:Ankhd1	APN	18	36632072	missense	probably benign	0.01
IGL01367:Ankhd1	APN	18	36578643	missense	probably benign	0.16
IGL01624:Ankhd1	APN	18	36658013	missense	probably damaging	1.00
IGL01725:Ankhd1	APN	18	36648153	missense	probably benign	0.04
IGL01767:Ankhd1	APN	18	36648374	missense	probably damaging	1.00
IGL02005:Ankhd1	APN	18	36648426	missense	probably damaging	1.00
IGL02009:Ankhd1	APN	18	36624661	missense	probably damaging	1.00
IGL02246:Ankhd1	APN	18	36656726	missense	probably damaging	1.00
IGL02336:Ankhd1	APN	18	36594814	missense	probably damaging	0.97
IGL02628:Ankhd1	APN	18	36647703	missense	probably benign	0.00
IGL02644:Ankhd1	APN	18	36578775	critical splice donor site	probably null
IGL02735:Ankhd1	APN	18	36648546	missense	probably benign	0.00
IGL02877:Ankhd1	APN	18	36594823	missense	probably damaging	1.00
IGL03129:Ankhd1	APN	18	36658008	nonsense	probably null
IGL03163:Ankhd1	APN	18	36647628	missense	probably damaging	0.97
IGL03182:Ankhd1	APN	18	36578774	missense	probably benign	0.06
IGL03184:Ankhd1	APN	18	36647777	missense	probably damaging	1.00
IGL03398:Ankhd1	APN	18	36656837	splice site	probably benign
FR4304:Ankhd1	UTSW	18	36560924	small insertion	probably benign
R0051:Ankhd1	UTSW	18	36647188	unclassified	probably benign
R0089:Ankhd1	UTSW	18	36640356	missense	probably damaging	0.99
R0105:Ankhd1	UTSW	18	36646766	missense	probably damaging	1.00
R0149:Ankhd1	UTSW	18	36647214	missense	probably damaging	1.00
R0243:Ankhd1	UTSW	18	36634734	missense	probably damaging	1.00
R0322:Ankhd1	UTSW	18	36658008	nonsense	probably null
R0361:Ankhd1	UTSW	18	36647214	missense	probably damaging	1.00
R0389:Ankhd1	UTSW	18	36644599	missense	possibly damaging	0.48
R0418:Ankhd1	UTSW	18	36634300	missense	probably damaging	1.00
R0443:Ankhd1	UTSW	18	36644599	missense	possibly damaging	0.48
R0540:Ankhd1	UTSW	18	36640280	missense	probably damaging	1.00
R0607:Ankhd1	UTSW	18	36640280	missense	probably damaging	1.00
R1127:Ankhd1	UTSW	18	36634346	missense	probably damaging	1.00
R1434:Ankhd1	UTSW	18	36625159	missense	probably benign	0.09
R1742:Ankhd1	UTSW	18	36625265	missense	probably damaging	1.00
R1776:Ankhd1	UTSW	18	36647308	missense	probably benign	0.17
R1856:Ankhd1	UTSW	18	36644527	missense	probably benign	0.00
R1923:Ankhd1	UTSW	18	36648030	missense	probably benign	0.08
R2044:Ankhd1	UTSW	18	36645113	missense	probably benign	0.31
R2112:Ankhd1	UTSW	18	36641626	missense	probably damaging	1.00
R2115:Ankhd1	UTSW	18	36634308	missense	probably damaging	1.00
R2136:Ankhd1	UTSW	18	36647621	missense	probably benign
R2196:Ankhd1	UTSW	18	36648379	missense	probably damaging	1.00
R2291:Ankhd1	UTSW	18	36644333	missense	probably benign	0.31
R2305:Ankhd1	UTSW	18	36642926	missense	possibly damaging	0.59
R2309:Ankhd1	UTSW	18	36624765	missense	probably damaging	1.00
R2519:Ankhd1	UTSW	18	36578543	splice site	probably null
R2958:Ankhd1	UTSW	18	36634729	missense	probably damaging	1.00
R3978:Ankhd1	UTSW	18	36647613	missense	probably damaging	0.96
R3980:Ankhd1	UTSW	18	36647613	missense	probably damaging	0.96
R4159:Ankhd1	UTSW	18	36589540	missense	possibly damaging	0.91
R4199:Ankhd1	UTSW	18	36661048	unclassified	probably benign
R4323:Ankhd1	UTSW	18	36578633	missense	probably damaging	1.00
R4356:Ankhd1	UTSW	18	36643043	nonsense	probably null
R4496:Ankhd1	UTSW	18	36560786	missense	probably damaging	0.98
R4551:Ankhd1	UTSW	18	36655507	splice site	probably null
R4590:Ankhd1	UTSW	18	36583644	missense	probably damaging	1.00
R4667:Ankhd1	UTSW	18	36648021	missense	possibly damaging	0.77
R4889:Ankhd1	UTSW	18	36578734	missense	probably null	0.00
R4923:Ankhd1	UTSW	18	36589452	missense	probably damaging	1.00
R5091:Ankhd1	UTSW	18	36625027	missense	possibly damaging	0.68
R5254:Ankhd1	UTSW	18	36656715	missense	probably benign	0.05
R5314:Ankhd1	UTSW	18	36561058	splice site	probably null
R5336:Ankhd1	UTSW	18	36646716	missense	probably damaging	1.00
R5367:Ankhd1	UTSW	18	36589408	missense	probably damaging	1.00
R5384:Ankhd1	UTSW	18	36591495	missense	probably damaging	1.00
R5385:Ankhd1	UTSW	18	36591495	missense	probably damaging	1.00
R5387:Ankhd1	UTSW	18	36634644	missense	probably damaging	1.00
R5458:Ankhd1	UTSW	18	36648485	missense	probably benign	0.01
R5599:Ankhd1	UTSW	18	36560807	missense	probably damaging	0.98
R5659:Ankhd1	UTSW	18	36561050	missense	probably damaging	1.00
R5750:Ankhd1	UTSW	18	36624902	missense	probably benign	0.00
R5874:Ankhd1	UTSW	18	36640269	missense	possibly damaging	0.92
R5894:Ankhd1	UTSW	18	36647524	missense	probably damaging	0.99
R5969:Ankhd1	UTSW	18	36600834	missense	probably damaging	1.00
R6133:Ankhd1	UTSW	18	36625126	missense	possibly damaging	0.77
R6190:Ankhd1	UTSW	18	36611809	missense	possibly damaging	0.84
R6247:Ankhd1	UTSW	18	36654146	missense	probably benign	0.00
R6512:Ankhd1	UTSW	18	36591456	missense	probably damaging	1.00
R6649:Ankhd1	UTSW	18	36600783	splice site	probably null
R6653:Ankhd1	UTSW	18	36600783	splice site	probably null
R6763:Ankhd1	UTSW	18	36642969	missense	probably benign	0.31
R6976:Ankhd1	UTSW	18	36648254	missense	probably benign	0.00
R7075:Ankhd1	UTSW	18	36559989	missense
R7208:Ankhd1	UTSW	18	36625028	missense	probably benign
R7305:Ankhd1	UTSW	18	36632205	missense
R7615:Ankhd1	UTSW	18	36656773	missense
R7654:Ankhd1	UTSW	18	36594101	missense	probably damaging	1.00
R7781:Ankhd1	UTSW	18	36625205	missense	probably damaging	1.00
R7842:Ankhd1	UTSW	18	36647828	missense	probably benign	0.00
R7965:Ankhd1	UTSW	18	36658412	missense
R8006:Ankhd1	UTSW	18	36648719	missense
R8037:Ankhd1	UTSW	18	36638623	missense	probably damaging	0.98
R8123:Ankhd1	UTSW	18	36575083	missense
R8195:Ankhd1	UTSW	18	36654177	missense
R8305:Ankhd1	UTSW	18	36647166	missense	possibly damaging	0.79
RF001:Ankhd1	UTSW	18	36560921	small insertion	probably benign
RF004:Ankhd1	UTSW	18	36560910	small insertion	probably benign
RF007:Ankhd1	UTSW	18	36560909	small insertion	probably benign
RF008:Ankhd1	UTSW	18	36560924	small insertion	probably benign
RF009:Ankhd1	UTSW	18	36560922	small insertion	probably benign
RF013:Ankhd1	UTSW	18	36560926	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36560909	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36560910	small insertion	probably benign
RF017:Ankhd1	UTSW	18	36560909	small insertion	probably benign
RF018:Ankhd1	UTSW	18	36560912	small insertion	probably benign
RF026:Ankhd1	UTSW	18	36560912	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36560913	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36560927	small insertion	probably benign
RF039:Ankhd1	UTSW	18	36560918	small insertion	probably benign
RF043:Ankhd1	UTSW	18	36560917	small insertion	probably benign
RF046:Ankhd1	UTSW	18	36560926	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36560917	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36560923	small insertion	probably benign
RF049:Ankhd1	UTSW	18	36560923	small insertion	probably benign
RF050:Ankhd1	UTSW	18	36560927	small insertion	probably benign
RF054:Ankhd1	UTSW	18	36560929	small insertion	probably benign
RF057:Ankhd1	UTSW	18	36560929	small insertion	probably benign
RF060:Ankhd1	UTSW	18	36560922	small insertion	probably benign
RF061:Ankhd1	UTSW	18	36560921	small insertion	probably benign
RF062:Ankhd1	UTSW	18	36560918	small insertion	probably benign
X0027:Ankhd1	UTSW	18	36624832	missense	probably damaging	1.00
X0065:Ankhd1	UTSW	18	36578764	nonsense	probably null
X0066:Ankhd1	UTSW	18	36646704	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATTTTCTCAGCCTTGATGGTGA -3'
(R):5'- catctttccagctccCAGTGTTGT -3'

Sequencing Primer
(F):5'- CAGCCTTGATGGTGAAGTAAATTCC -3'
(R):5'- AGGCCAGGAAAGCCTAATGA -3'

Posted On

2013-09-30