Mutagenetix > Incidental Mutation

Incidental Mutation 'R9317:Vmn2r72'

705914

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r72

Ensembl Gene

ENSMUSG00000051877

Gene Name

vomeronasal 2, receptor 72

Synonyms

Vmn2r72-ps, EG244114

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R9317 (G1)

Quality Score

165.009

Status

Not validated

Chromosome

Chromosomal Location

85737784-85754981 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85754814 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 56 (N56K)

Ref Sequence

ENSEMBL: ENSMUSP00000133014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063425]

AlphaFold

D3Z4N8

Predicted Effect

probably benign
Transcript: ENSMUST00000063425
AA Change: N56K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: N56K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	82	469	2.3e-28	PFAM
Pfam:NCD3G	512	564	1.2e-18	PFAM
Pfam:7tm_3	594	832	4e-53	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	T	C	8: 119,615,441	L307P	probably damaging	Het
Apcdd1	C	T	18: 62,922,660		probably benign	Het
C130060K24Rik	A	C	6: 65,447,384	I174L	probably benign	Het
C1qbp	T	C	11: 70,978,103	N278D	probably benign	Het
Cd68	C	T	11: 69,665,034		probably null	Het
Cdc37l1	T	G	19: 28,995,118	N70K	probably damaging	Het
Cyp3a57	T	C	5: 145,372,611	V253A	possibly damaging	Het
Dnmt1	A	G	9: 20,918,279	F795S	probably damaging	Het
Gli3	T	A	13: 15,715,073	S591T	probably damaging	Het
Gmeb1	A	T	4: 132,226,038	S472R	probably benign	Het
Gpr158	T	C	2: 21,827,226	S1046P	probably benign	Het
Grik5	A	G	7: 25,046,235	L471P	probably damaging	Het
Hmcn2	G	A	2: 31,460,316	R5075H	possibly damaging	Het
Hspa5	G	T	2: 34,776,058	S638I	probably benign	Het
Ilf3	A	G	9: 21,396,126	Y355C	probably damaging	Het
Kalrn	T	C	16: 34,013,675	T2366A		Het
Negr1	T	A	3: 157,198,444	C315S	probably benign	Het
Olfr136	A	T	17: 38,335,429	T91S	possibly damaging	Het
Olfr917	T	A	9: 38,665,359	M162L	probably benign	Het
Prr5	C	T	15: 84,699,123	Q110*	probably null	Het
Prune2	T	A	19: 17,121,670	S1513T	probably benign	Het
Ptprk	A	G	10: 28,354,735	E274G	probably damaging	Het
Rmdn3	G	A	2: 119,156,510	A12V	unknown	Het
Rpf1	A	G	3: 146,512,261	V166A	probably benign	Het
Senp5	A	C	16: 31,983,572	F554C	probably damaging	Het
Smarca2	T	C	19: 26,759,879	C65R	possibly damaging	Het
Sprr2j-ps	T	A	3: 92,418,871	C18S	unknown	Het
Sult2a6	A	T	7: 14,236,690	Y160*	probably null	Het
Taar8a	T	C	10: 24,076,855	V119A	probably benign	Het
Tmtc3	T	C	10: 100,466,034	K351R	probably benign	Het
Trpc1	A	G	9: 95,721,222	L419P	probably damaging	Het
Ttn	T	C	2: 76,811,355	K13466E	possibly damaging	Het
Unc13c	A	G	9: 73,540,380	F1846S	possibly damaging	Het
Usp48	G	A	4: 137,613,685	G332E	probably benign	Het
Wdr12	C	A	1: 60,089,296	M98I	probably benign	Het
Zfp953	T	C	13: 67,343,393	Y165C	possibly damaging	Het

Other mutations in Vmn2r72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Vmn2r72	APN	7	85749646	missense	probably benign	0.01
IGL01019:Vmn2r72	APN	7	85738334	missense	probably benign	0.26
IGL01445:Vmn2r72	APN	7	85749646	missense	probably benign	0.06
IGL02076:Vmn2r72	APN	7	85738367	missense	probably damaging	1.00
IGL02082:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02086:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02089:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02125:Vmn2r72	APN	7	85750711	missense	probably benign	0.00
IGL02146:Vmn2r72	APN	7	85737962	missense	probably damaging	1.00
IGL02272:Vmn2r72	APN	7	85750693	missense	probably benign
IGL02514:Vmn2r72	APN	7	85738699	missense	possibly damaging	0.90
IGL02662:Vmn2r72	APN	7	85738183	missense	probably benign	0.26
IGL02697:Vmn2r72	APN	7	85738671	missense	probably benign	0.36
IGL02733:Vmn2r72	APN	7	85751813	missense	probably benign	0.05
IGL03070:Vmn2r72	APN	7	85752041	splice site	probably benign
IGL03150:Vmn2r72	APN	7	85751176	missense	probably damaging	1.00
IGL03159:Vmn2r72	APN	7	85754954	missense	probably benign	0.05
IGL03333:Vmn2r72	APN	7	85750867	missense	probably benign	0.10
R0081:Vmn2r72	UTSW	7	85751836	missense	probably benign	0.01
R0090:Vmn2r72	UTSW	7	85754876	missense	probably benign
R0655:Vmn2r72	UTSW	7	85738111	nonsense	probably null
R0778:Vmn2r72	UTSW	7	85749739	missense	probably benign	0.00
R1169:Vmn2r72	UTSW	7	85751309	missense	probably benign	0.01
R1172:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1173:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1175:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1248:Vmn2r72	UTSW	7	85749188	missense	probably benign	0.02
R1302:Vmn2r72	UTSW	7	85738257	missense	probably damaging	1.00
R1506:Vmn2r72	UTSW	7	85749211	missense	probably benign
R1632:Vmn2r72	UTSW	7	85751792	missense	probably benign	0.13
R1775:Vmn2r72	UTSW	7	85738170	missense	probably benign	0.01
R1962:Vmn2r72	UTSW	7	85749161	missense	probably benign	0.00
R2201:Vmn2r72	UTSW	7	85738236	missense	probably benign	0.12
R2290:Vmn2r72	UTSW	7	85738341	missense	probably damaging	1.00
R2327:Vmn2r72	UTSW	7	85738256	missense	probably damaging	1.00
R2424:Vmn2r72	UTSW	7	85750953	missense	probably damaging	1.00
R2655:Vmn2r72	UTSW	7	85751269	missense	possibly damaging	0.95
R2860:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2861:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2862:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R3009:Vmn2r72	UTSW	7	85749642	missense	probably benign	0.00
R3797:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3798:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3902:Vmn2r72	UTSW	7	85749735	missense	possibly damaging	0.52
R3959:Vmn2r72	UTSW	7	85751131	missense	probably benign	0.36
R3974:Vmn2r72	UTSW	7	85749809	missense	probably damaging	1.00
R4399:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4421:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4426:Vmn2r72	UTSW	7	85737828	nonsense	probably null
R4522:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4523:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4533:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4691:Vmn2r72	UTSW	7	85737911	nonsense	probably null
R4781:Vmn2r72	UTSW	7	85737861	missense	probably benign	0.14
R4863:Vmn2r72	UTSW	7	85750598	missense	possibly damaging	0.91
R4952:Vmn2r72	UTSW	7	85751109	missense	probably benign
R4991:Vmn2r72	UTSW	7	85751130	missense	probably damaging	0.99
R4995:Vmn2r72	UTSW	7	85738485	missense	probably damaging	1.00
R5095:Vmn2r72	UTSW	7	85737853	missense	probably damaging	0.98
R5174:Vmn2r72	UTSW	7	85737840	missense	probably benign	0.00
R5276:Vmn2r72	UTSW	7	85738254	missense	possibly damaging	0.90
R5395:Vmn2r72	UTSW	7	85750897	missense	possibly damaging	0.71
R5560:Vmn2r72	UTSW	7	85751942	missense	probably damaging	0.96
R5933:Vmn2r72	UTSW	7	85737850	missense	probably benign	0.05
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6354:Vmn2r72	UTSW	7	85750539	critical splice donor site	probably null
R6362:Vmn2r72	UTSW	7	85751174	missense	probably damaging	1.00
R6594:Vmn2r72	UTSW	7	85749684	missense	probably benign	0.32
R6794:Vmn2r72	UTSW	7	85737996	missense	probably damaging	1.00
R7113:Vmn2r72	UTSW	7	85749803	splice site	probably null
R7189:Vmn2r72	UTSW	7	85754917	missense	probably benign	0.36
R7266:Vmn2r72	UTSW	7	85738274	nonsense	probably null
R7323:Vmn2r72	UTSW	7	85750563	missense	probably benign
R7426:Vmn2r72	UTSW	7	85751140	missense	probably benign
R7606:Vmn2r72	UTSW	7	85751154	missense	possibly damaging	0.91
R7651:Vmn2r72	UTSW	7	85751938	missense	probably damaging	1.00
R7688:Vmn2r72	UTSW	7	85754890	missense	probably benign	0.32
R7753:Vmn2r72	UTSW	7	85750626	missense	probably damaging	1.00
R7843:Vmn2r72	UTSW	7	85749630	missense	probably benign	0.01
R8157:Vmn2r72	UTSW	7	85751233	missense	probably benign	0.09
R8254:Vmn2r72	UTSW	7	85751019	missense	probably damaging	1.00
R8389:Vmn2r72	UTSW	7	85751960	missense	probably damaging	0.99
R8444:Vmn2r72	UTSW	7	85738175	missense	probably benign
R8989:Vmn2r72	UTSW	7	85754926	missense	probably benign	0.10
R9015:Vmn2r72	UTSW	7	85749180	missense	probably benign	0.01
R9080:Vmn2r72	UTSW	7	85738256	missense	probably damaging	1.00
R9269:Vmn2r72	UTSW	7	85751203	missense	probably benign	0.03
R9509:Vmn2r72	UTSW	7	85754867	missense	probably benign
Z1176:Vmn2r72	UTSW	7	85749191	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAATACCGTGTTTCATTCATTCAGC -3'
(R):5'- CAGGCAGATATCTTGCTGGC -3'

Sequencing Primer
(F):5'- AGGTACTCATAAAACAACCAGAATTG -3'
(R):5'- TATCTTGCTGGCAGGATAAAGATG -3'

Posted On

2022-03-25