Incidental Mutation 'R9317:Vmn2r72'
ID 705914
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Name vomeronasal 2, receptor 72
Synonyms Vmn2r72-ps, EG244114
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock # R9317 (G1)
Quality Score 165.009
Status Not validated
Chromosome 7
Chromosomal Location 85737784-85754981 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85754814 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 56 (N56K)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
AlphaFold D3Z4N8
Predicted Effect probably benign
Transcript: ENSMUST00000063425
AA Change: N56K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: N56K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T C 8: 119,615,441 L307P probably damaging Het
Apcdd1 C T 18: 62,922,660 probably benign Het
C130060K24Rik A C 6: 65,447,384 I174L probably benign Het
C1qbp T C 11: 70,978,103 N278D probably benign Het
Cd68 C T 11: 69,665,034 probably null Het
Cdc37l1 T G 19: 28,995,118 N70K probably damaging Het
Cyp3a57 T C 5: 145,372,611 V253A possibly damaging Het
Dnmt1 A G 9: 20,918,279 F795S probably damaging Het
Gli3 T A 13: 15,715,073 S591T probably damaging Het
Gmeb1 A T 4: 132,226,038 S472R probably benign Het
Gpr158 T C 2: 21,827,226 S1046P probably benign Het
Grik5 A G 7: 25,046,235 L471P probably damaging Het
Hmcn2 G A 2: 31,460,316 R5075H possibly damaging Het
Hspa5 G T 2: 34,776,058 S638I probably benign Het
Ilf3 A G 9: 21,396,126 Y355C probably damaging Het
Kalrn T C 16: 34,013,675 T2366A Het
Negr1 T A 3: 157,198,444 C315S probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr917 T A 9: 38,665,359 M162L probably benign Het
Prr5 C T 15: 84,699,123 Q110* probably null Het
Prune2 T A 19: 17,121,670 S1513T probably benign Het
Ptprk A G 10: 28,354,735 E274G probably damaging Het
Rmdn3 G A 2: 119,156,510 A12V unknown Het
Rpf1 A G 3: 146,512,261 V166A probably benign Het
Senp5 A C 16: 31,983,572 F554C probably damaging Het
Smarca2 T C 19: 26,759,879 C65R possibly damaging Het
Sprr2j-ps T A 3: 92,418,871 C18S unknown Het
Sult2a6 A T 7: 14,236,690 Y160* probably null Het
Taar8a T C 10: 24,076,855 V119A probably benign Het
Tmtc3 T C 10: 100,466,034 K351R probably benign Het
Trpc1 A G 9: 95,721,222 L419P probably damaging Het
Ttn T C 2: 76,811,355 K13466E possibly damaging Het
Unc13c A G 9: 73,540,380 F1846S possibly damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Wdr12 C A 1: 60,089,296 M98I probably benign Het
Zfp953 T C 13: 67,343,393 Y165C possibly damaging Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 splice site probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85751019 missense probably damaging 1.00
R8389:Vmn2r72 UTSW 7 85751960 missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85738175 missense probably benign
R8989:Vmn2r72 UTSW 7 85754926 missense probably benign 0.10
R9015:Vmn2r72 UTSW 7 85749180 missense probably benign 0.01
R9080:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R9269:Vmn2r72 UTSW 7 85751203 missense probably benign 0.03
R9509:Vmn2r72 UTSW 7 85754867 missense probably benign
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAATACCGTGTTTCATTCATTCAGC -3'
(R):5'- CAGGCAGATATCTTGCTGGC -3'

Sequencing Primer
(F):5'- AGGTACTCATAAAACAACCAGAATTG -3'
(R):5'- TATCTTGCTGGCAGGATAAAGATG -3'
Posted On 2022-03-25