Incidental Mutation 'R0738:Pcdhb4'
ID70592
Institutional Source Beutler Lab
Gene Symbol Pcdhb4
Ensembl Gene ENSMUSG00000045689
Gene Nameprotocadherin beta 4
SynonymsPcdhbD, Pcdhb5A
MMRRC Submission 038919-MU
Accession Numbers

Ncbi RefSeq: NM_053129.3; MGI:2136738

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37307455-37311172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37308711 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 358 (N358S)
Ref Sequence ENSEMBL: ENSMUSP00000059770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056712
AA Change: N358S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689
AA Change: N358S

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193025
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.2078 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Pcdhb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Pcdhb4 APN 18 37309916 missense possibly damaging 0.68
IGL01319:Pcdhb4 APN 18 37308513 missense probably benign
IGL01325:Pcdhb4 APN 18 37309623 missense probably damaging 1.00
IGL01608:Pcdhb4 APN 18 37308750 missense probably damaging 1.00
IGL01808:Pcdhb4 APN 18 37309014 missense probably damaging 1.00
IGL01962:Pcdhb4 APN 18 37309004 missense possibly damaging 0.90
IGL02280:Pcdhb4 APN 18 37307682 missense probably benign 0.00
IGL02622:Pcdhb4 APN 18 37309668 missense probably benign 0.00
IGL03025:Pcdhb4 APN 18 37309977 missense possibly damaging 0.62
IGL03137:Pcdhb4 APN 18 37308516 missense probably damaging 0.98
P0031:Pcdhb4 UTSW 18 37308885 missense probably damaging 1.00
R0385:Pcdhb4 UTSW 18 37309215 missense probably damaging 1.00
R0611:Pcdhb4 UTSW 18 37308210 missense probably damaging 1.00
R0671:Pcdhb4 UTSW 18 37307742 missense probably benign 0.01
R0853:Pcdhb4 UTSW 18 37309885 nonsense probably null
R0893:Pcdhb4 UTSW 18 37309370 splice site probably null
R1932:Pcdhb4 UTSW 18 37309541 missense probably benign 0.33
R1945:Pcdhb4 UTSW 18 37308868 missense probably damaging 1.00
R2194:Pcdhb4 UTSW 18 37308735 missense probably damaging 1.00
R2273:Pcdhb4 UTSW 18 37308926 missense probably damaging 1.00
R3807:Pcdhb4 UTSW 18 37309314 missense probably damaging 0.98
R3815:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3816:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3974:Pcdhb4 UTSW 18 37308848 missense possibly damaging 0.55
R4558:Pcdhb4 UTSW 18 37309964 missense probably benign
R4606:Pcdhb4 UTSW 18 37308652 missense probably damaging 1.00
R4615:Pcdhb4 UTSW 18 37308500 missense probably benign 0.02
R4840:Pcdhb4 UTSW 18 37308399 missense possibly damaging 0.60
R5240:Pcdhb4 UTSW 18 37309926 missense possibly damaging 0.78
R5272:Pcdhb4 UTSW 18 37307766 missense probably benign 0.04
R5586:Pcdhb4 UTSW 18 37308981 missense probably damaging 1.00
R5683:Pcdhb4 UTSW 18 37308989 missense probably benign 0.45
R5917:Pcdhb4 UTSW 18 37309566 missense probably damaging 1.00
R6110:Pcdhb4 UTSW 18 37308429 missense possibly damaging 0.80
R6383:Pcdhb4 UTSW 18 37308021 missense probably damaging 1.00
R6877:Pcdhb4 UTSW 18 37309572 missense probably damaging 1.00
R7036:Pcdhb4 UTSW 18 37308782 missense possibly damaging 0.95
R7204:Pcdhb4 UTSW 18 37309239 missense probably damaging 1.00
R7271:Pcdhb4 UTSW 18 37308169 missense possibly damaging 0.89
R7436:Pcdhb4 UTSW 18 37309275 missense probably damaging 1.00
R7444:Pcdhb4 UTSW 18 37309452 missense probably damaging 1.00
R7614:Pcdhb4 UTSW 18 37309549 missense probably benign 0.40
R7650:Pcdhb4 UTSW 18 37309614 missense probably damaging 1.00
R7664:Pcdhb4 UTSW 18 37309240 missense probably damaging 1.00
R8080:Pcdhb4 UTSW 18 37309296 missense probably benign 0.42
R8087:Pcdhb4 UTSW 18 37308664 missense probably damaging 1.00
R8115:Pcdhb4 UTSW 18 37309400 missense probably damaging 0.99
Z1177:Pcdhb4 UTSW 18 37309913 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGTGCAGGTTCCCGAGAATTTCC -3'
(R):5'- CCCATGTCTGAGACAGTGATGGTG -3'

Sequencing Primer
(F):5'- TGATGGAGACTCCCAACCATTTG -3'
(R):5'- TGATGTTGTACTCAGCGATACTC -3'
Posted On2013-09-30