Incidental Mutation 'R9317:Gli3'
ID 705926
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms Bph, brachyphalangy
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9317 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 15638308-15904611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15889658 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 591 (S591T)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510] [ENSMUST00000130065]
AlphaFold Q61602
Predicted Effect probably damaging
Transcript: ENSMUST00000110510
AA Change: S591T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: S591T

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130065
AA Change: S591T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115989
Gene: ENSMUSG00000021318
AA Change: S591T

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 596 1.45e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T C 8: 120,342,180 (GRCm39) L307P probably damaging Het
Apcdd1 C T 18: 63,055,731 (GRCm39) probably benign Het
C1qbp T C 11: 70,868,929 (GRCm39) N278D probably benign Het
Cd68 C T 11: 69,555,860 (GRCm39) probably null Het
Cdc37l1 T G 19: 28,972,518 (GRCm39) N70K probably damaging Het
Cyp3a57 T C 5: 145,309,421 (GRCm39) V253A possibly damaging Het
Dnmt1 A G 9: 20,829,575 (GRCm39) F795S probably damaging Het
Gmeb1 A T 4: 131,953,349 (GRCm39) S472R probably benign Het
Gpr158 T C 2: 21,832,037 (GRCm39) S1046P probably benign Het
Grik5 A G 7: 24,745,660 (GRCm39) L471P probably damaging Het
Hmcn2 G A 2: 31,350,328 (GRCm39) R5075H possibly damaging Het
Hspa5 G T 2: 34,666,070 (GRCm39) S638I probably benign Het
Ilf3 A G 9: 21,307,422 (GRCm39) Y355C probably damaging Het
Kalrn T C 16: 33,834,045 (GRCm39) T2366A Het
Negr1 T A 3: 156,904,081 (GRCm39) C315S probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or8b52 T A 9: 38,576,655 (GRCm39) M162L probably benign Het
Prr5 C T 15: 84,583,324 (GRCm39) Q110* probably null Het
Prune2 T A 19: 17,099,034 (GRCm39) S1513T probably benign Het
Ptprk A G 10: 28,230,731 (GRCm39) E274G probably damaging Het
Qrfprl A C 6: 65,424,368 (GRCm39) I174L probably benign Het
Rmdn3 G A 2: 118,986,991 (GRCm39) A12V unknown Het
Rpf1 A G 3: 146,218,016 (GRCm39) V166A probably benign Het
Senp5 A C 16: 31,802,390 (GRCm39) F554C probably damaging Het
Smarca2 T C 19: 26,737,279 (GRCm39) C65R possibly damaging Het
Sprr2j-ps T A 3: 92,326,178 (GRCm39) C18S unknown Het
Sult2a6 A T 7: 13,970,615 (GRCm39) Y160* probably null Het
Taar8a T C 10: 23,952,753 (GRCm39) V119A probably benign Het
Tmtc3 T C 10: 100,301,896 (GRCm39) K351R probably benign Het
Trpc1 A G 9: 95,603,275 (GRCm39) L419P probably damaging Het
Ttn T C 2: 76,641,699 (GRCm39) K13466E possibly damaging Het
Unc13c A G 9: 73,447,662 (GRCm39) F1846S possibly damaging Het
Usp48 G A 4: 137,340,996 (GRCm39) G332E probably benign Het
Vmn2r72 A T 7: 85,404,022 (GRCm39) N56K probably benign Het
Wdr12 C A 1: 60,128,455 (GRCm39) M98I probably benign Het
Zfp953 T C 13: 67,491,457 (GRCm39) Y165C possibly damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15,818,884 (GRCm39) missense probably damaging 1.00
IGL00471:Gli3 APN 13 15,898,354 (GRCm39) critical splice donor site probably null
IGL00484:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15,722,983 (GRCm39) critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15,823,219 (GRCm39) missense probably damaging 1.00
IGL01799:Gli3 APN 13 15,900,746 (GRCm39) missense probably benign 0.00
IGL01861:Gli3 APN 13 15,899,910 (GRCm39) missense probably damaging 1.00
IGL02063:Gli3 APN 13 15,900,957 (GRCm39) missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15,837,099 (GRCm39) missense probably damaging 1.00
IGL02255:Gli3 APN 13 15,823,304 (GRCm39) missense probably damaging 1.00
IGL02270:Gli3 APN 13 15,901,371 (GRCm39) utr 3 prime probably benign
IGL02336:Gli3 APN 13 15,894,874 (GRCm39) missense probably damaging 1.00
IGL02346:Gli3 APN 13 15,898,278 (GRCm39) missense probably damaging 1.00
IGL02744:Gli3 APN 13 15,788,471 (GRCm39) critical splice donor site probably null
IGL02877:Gli3 APN 13 15,899,327 (GRCm39) missense probably damaging 1.00
IGL02975:Gli3 APN 13 15,899,153 (GRCm39) missense probably damaging 1.00
IGL03018:Gli3 APN 13 15,834,717 (GRCm39) missense probably damaging 1.00
IGL03378:Gli3 APN 13 15,819,005 (GRCm39) missense probably damaging 1.00
IGL03406:Gli3 APN 13 15,823,166 (GRCm39) missense probably damaging 1.00
Capone UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
Carpals UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
Ness UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15,818,942 (GRCm39) missense probably damaging 1.00
R0110:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0329:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0330:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0360:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0364:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0469:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0616:Gli3 UTSW 13 15,836,991 (GRCm39) missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15,899,300 (GRCm39) missense probably damaging 1.00
R1072:Gli3 UTSW 13 15,888,190 (GRCm39) missense probably damaging 1.00
R1257:Gli3 UTSW 13 15,900,581 (GRCm39) nonsense probably null
R1270:Gli3 UTSW 13 15,898,329 (GRCm39) missense probably benign 0.02
R1424:Gli3 UTSW 13 15,900,899 (GRCm39) missense probably benign 0.00
R1481:Gli3 UTSW 13 15,788,435 (GRCm39) missense probably damaging 0.99
R1596:Gli3 UTSW 13 15,900,056 (GRCm39) missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15,900,897 (GRCm39) missense probably benign 0.00
R1721:Gli3 UTSW 13 15,900,882 (GRCm39) missense probably benign 0.27
R1797:Gli3 UTSW 13 15,888,097 (GRCm39) missense probably damaging 0.99
R1813:Gli3 UTSW 13 15,823,276 (GRCm39) missense probably damaging 1.00
R1819:Gli3 UTSW 13 15,900,377 (GRCm39) nonsense probably null
R1988:Gli3 UTSW 13 15,900,965 (GRCm39) missense probably benign
R2132:Gli3 UTSW 13 15,900,134 (GRCm39) missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15,836,977 (GRCm39) missense probably benign 0.02
R3085:Gli3 UTSW 13 15,835,526 (GRCm39) missense probably damaging 1.00
R3177:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R3277:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R4162:Gli3 UTSW 13 15,899,700 (GRCm39) missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15,898,156 (GRCm39) missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15,888,216 (GRCm39) missense probably damaging 1.00
R4979:Gli3 UTSW 13 15,899,049 (GRCm39) missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15,723,092 (GRCm39) missense probably damaging 0.99
R5395:Gli3 UTSW 13 15,889,535 (GRCm39) missense probably damaging 1.00
R5494:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R5609:Gli3 UTSW 13 15,723,038 (GRCm39) missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15,652,750 (GRCm39) critical splice donor site probably null
R5810:Gli3 UTSW 13 15,818,894 (GRCm39) missense probably damaging 0.99
R5896:Gli3 UTSW 13 15,900,765 (GRCm39) missense probably benign 0.00
R5930:Gli3 UTSW 13 15,723,210 (GRCm39) missense probably damaging 1.00
R5964:Gli3 UTSW 13 15,900,747 (GRCm39) nonsense probably null
R5985:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6224:Gli3 UTSW 13 15,899,730 (GRCm39) missense probably benign
R6278:Gli3 UTSW 13 15,899,698 (GRCm39) missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15,899,317 (GRCm39) missense probably damaging 1.00
R6383:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6523:Gli3 UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
R7072:Gli3 UTSW 13 15,900,280 (GRCm39) missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15,889,647 (GRCm39) missense probably damaging 1.00
R7228:Gli3 UTSW 13 15,899,087 (GRCm39) missense probably benign 0.00
R7327:Gli3 UTSW 13 15,900,144 (GRCm39) missense probably benign 0.02
R7451:Gli3 UTSW 13 15,900,876 (GRCm39) missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15,900,841 (GRCm39) missense probably benign 0.00
R8167:Gli3 UTSW 13 15,900,228 (GRCm39) missense probably benign 0.00
R8170:Gli3 UTSW 13 15,894,793 (GRCm39) missense probably benign
R8199:Gli3 UTSW 13 15,900,576 (GRCm39) missense probably benign 0.08
R8247:Gli3 UTSW 13 15,901,360 (GRCm39) missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15,888,133 (GRCm39) missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15,898,110 (GRCm39) missense probably damaging 1.00
R8559:Gli3 UTSW 13 15,834,717 (GRCm39) missense probably damaging 1.00
R8676:Gli3 UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
R8905:Gli3 UTSW 13 15,901,116 (GRCm39) missense probably benign 0.01
R9099:Gli3 UTSW 13 15,901,320 (GRCm39) missense probably damaging 1.00
R9260:Gli3 UTSW 13 15,899,675 (GRCm39) missense probably damaging 0.99
R9475:Gli3 UTSW 13 15,900,296 (GRCm39) missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15,788,443 (GRCm39) missense probably benign 0.00
R9571:Gli3 UTSW 13 15,900,858 (GRCm39) missense probably benign 0.00
R9621:Gli3 UTSW 13 15,901,253 (GRCm39) missense probably benign 0.01
R9704:Gli3 UTSW 13 15,898,058 (GRCm39) missense probably damaging 1.00
R9787:Gli3 UTSW 13 15,900,386 (GRCm39) missense probably damaging 0.96
RF010:Gli3 UTSW 13 15,900,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTGACCCTTAAAAGGTC -3'
(R):5'- AACAGGGTTCATCCTTGAGG -3'

Sequencing Primer
(F):5'- GGCTGAACACAAGCTGCAGC -3'
(R):5'- GAGGCCTCAAACCTTCATCTG -3'
Posted On 2022-03-25