Incidental Mutation 'R9317:Apcdd1'
ID 705932
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R9317 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 62922660 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably benign
Transcript: ENSMUST00000096554
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163716
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T C 8: 119,615,441 L307P probably damaging Het
C130060K24Rik A C 6: 65,447,384 I174L probably benign Het
C1qbp T C 11: 70,978,103 N278D probably benign Het
Cd68 C T 11: 69,665,034 probably null Het
Cdc37l1 T G 19: 28,995,118 N70K probably damaging Het
Cyp3a57 T C 5: 145,372,611 V253A possibly damaging Het
Dnmt1 A G 9: 20,918,279 F795S probably damaging Het
Gli3 T A 13: 15,715,073 S591T probably damaging Het
Gmeb1 A T 4: 132,226,038 S472R probably benign Het
Gpr158 T C 2: 21,827,226 S1046P probably benign Het
Grik5 A G 7: 25,046,235 L471P probably damaging Het
Hmcn2 G A 2: 31,460,316 R5075H possibly damaging Het
Hspa5 G T 2: 34,776,058 S638I probably benign Het
Ilf3 A G 9: 21,396,126 Y355C probably damaging Het
Kalrn T C 16: 34,013,675 T2366A Het
Negr1 T A 3: 157,198,444 C315S probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr917 T A 9: 38,665,359 M162L probably benign Het
Prr5 C T 15: 84,699,123 Q110* probably null Het
Prune2 T A 19: 17,121,670 S1513T probably benign Het
Ptprk A G 10: 28,354,735 E274G probably damaging Het
Rmdn3 G A 2: 119,156,510 A12V unknown Het
Rpf1 A G 3: 146,512,261 V166A probably benign Het
Senp5 A C 16: 31,983,572 F554C probably damaging Het
Smarca2 T C 19: 26,759,879 C65R possibly damaging Het
Sprr2j-ps T A 3: 92,418,871 C18S unknown Het
Sult2a6 A T 7: 14,236,690 Y160* probably null Het
Taar8a T C 10: 24,076,855 V119A probably benign Het
Tmtc3 T C 10: 100,466,034 K351R probably benign Het
Trpc1 A G 9: 95,721,222 L419P probably damaging Het
Ttn T C 2: 76,811,355 K13466E possibly damaging Het
Unc13c A G 9: 73,540,380 F1846S possibly damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn2r72 A T 7: 85,754,814 N56K probably benign Het
Wdr12 C A 1: 60,089,296 M98I probably benign Het
Zfp953 T C 13: 67,343,393 Y165C possibly damaging Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGTACCTCTGAGCTGTGC -3'
(R):5'- GAGGTTCGCATCCTTCCAGAAAG -3'

Sequencing Primer
(F):5'- TCTGAGCTGTGCACGCC -3'
(R):5'- AAAACCACTGCGGGTGC -3'
Posted On 2022-03-25