Mutagenetix > Incidental Mutation

Incidental Mutation 'R9318:Rp1'

705936

Institutional Source

Beutler Lab

Gene Symbol

Rp1

Ensembl Gene

ENSMUSG00000025900

Gene Name

retinitis pigmentosa 1 (human)

Synonyms

Dcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R9318 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3999557-4409241 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 4348265 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 875 (A875T)

Ref Sequence

ENSEMBL: ENSMUSP00000027032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]

AlphaFold

P56716

Predicted Effect

probably benign
Transcript: ENSMUST00000027032
AA Change: A875T

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: A875T

Domain	Start	End	E-Value	Type
DCX	30	117	4.37e-39	SMART
low complexity region	120	133	N/A	INTRINSIC
DCX	152	236	7.17e-35	SMART
low complexity region	343	354	N/A	INTRINSIC
low complexity region	403	414	N/A	INTRINSIC
low complexity region	462	473	N/A	INTRINSIC
low complexity region	646	661	N/A	INTRINSIC
low complexity region	1113	1123	N/A	INTRINSIC
low complexity region	1396	1412	N/A	INTRINSIC
low complexity region	1434	1444	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194992

SMART Domains

Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

Domain	Start	End	E-Value	Type
DCX	40	127	4.37e-39	SMART
low complexity region	130	143	N/A	INTRINSIC
DCX	162	246	7.17e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000208660

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	A	G	15: 94,403,440	S68P	possibly damaging	Het
Adcy6	A	T	15: 98,593,585	N1044K	possibly damaging	Het
Ak9	T	G	10: 41,423,085	M1594R	unknown	Het
Angpt1	A	G	15: 42,438,355	I419T	probably benign	Het
Ankrd31	A	T	13: 96,878,577	L1451F	probably benign	Het
Ap1b1	T	C	11: 5,040,157	I860T	probably benign	Het
Apc	G	A	18: 34,313,987	R1312Q	possibly damaging	Het
Cadps2	A	G	6: 23,496,888	Y453H	probably benign	Het
Carmil2	A	G	8: 105,687,854	T148A	probably benign	Het
Ccdc125	A	G	13: 100,696,412	Y499C	probably damaging	Het
Ccdc14	A	G	16: 34,704,918	M194V	possibly damaging	Het
Ccdc162	C	A	10: 41,630,114	M893I	probably benign	Het
Ccdc33	C	A	9: 58,086,593	W335L	possibly damaging	Het
Chn2	T	A	6: 54,295,855	Y355N	probably damaging	Het
Chst13	G	A	6: 90,309,524	P152L	probably damaging	Het
Clec4g	A	G	8: 3,716,500	M267T	probably damaging	Het
Clybl	G	A	14: 122,371,403	V136I	probably damaging	Het
Ctnnd1	G	T	2: 84,608,338	Q877K	probably benign	Het
Derl3	A	G	10: 75,894,014	K94R	probably null	Het
Dnah2	T	C	11: 69,484,329	E1356G	probably benign	Het
Dnah5	A	C	15: 28,203,908		probably benign	Het
Dusp19	T	A	2: 80,631,000	V211E	probably benign	Het
Entpd7	T	A	19: 43,704,270	V88E	possibly damaging	Het
Fam114a1	T	A	5: 64,995,884	S140T	possibly damaging	Het
Fbxw13	A	G	9: 109,179,314	F456L	probably benign	Het
Fpr-rs4	A	T	17: 18,021,955	M75L	probably benign	Het
Gm11639	T	C	11: 104,965,822		probably null	Het
Grb14	T	G	2: 65,022,641	T2P	probably damaging	Het
Hace1	T	A	10: 45,652,673	S337T	probably benign	Het
Heatr5b	C	T	17: 78,765,402	V1611I	probably benign	Het
Hist2h2be	T	C	3: 96,221,365	V67A	probably benign	Het
Ints6	A	T	14: 62,696,698	S787T	probably benign	Het
Itga9	A	G	9: 118,626,468	K70R	probably benign	Het
Kcnt2	T	C	1: 140,425,195	I214T	probably damaging	Het
Kdelr3	C	A	15: 79,527,074	L203I	probably benign	Het
Kpnb1	A	G	11: 97,163,458	M842T	probably benign	Het
Lamc1	G	T	1: 153,252,000	R386S	probably damaging	Het
Lctl	A	G	9: 64,119,257		probably benign	Het
Lrrn3	G	A	12: 41,453,244	P358L	probably damaging	Het
Mag	T	C	7: 30,900,368	H582R	possibly damaging	Het
Megf9	A	T	4: 70,435,454	C372S	probably damaging	Het
Mfsd11	T	C	11: 116,859,572	F139S	probably damaging	Het
Mpst	G	T	15: 78,410,442	V125L	probably damaging	Het
Myo15b	T	C	11: 115,885,139	V587A	probably benign	Het
Myod1	A	T	7: 46,376,932	H87L	probably damaging	Het
Oacyl	G	T	18: 65,725,344	V247L	probably benign	Het
Olfr1116	A	C	2: 87,268,927	T49P	possibly damaging	Het
Olfr136	A	T	17: 38,335,429	T91S	possibly damaging	Het
Olfr177	A	G	16: 58,872,385	L255P	probably damaging	Het
Olfr181	A	T	16: 58,925,908	I221N	probably damaging	Het
Olfr350	G	A	2: 36,850,553	C169Y	probably benign	Het
Olfr598	T	A	7: 103,329,376	Y297N	probably damaging	Het
Olfr676	T	C	7: 105,035,623	Y142H	probably damaging	Het
Olfr804	A	G	10: 129,705,414	T179A	probably benign	Het
Olfr917	A	G	9: 38,665,284	S187P	possibly damaging	Het
Olfr983	A	C	9: 40,092,816	I50S	possibly damaging	Het
Pde3a	T	C	6: 141,479,476	F666S	probably benign	Het
Phf20	G	A	2: 156,273,770	R337H	probably benign	Het
Plcg2	G	A	8: 117,596,368	E721K	probably benign	Het
Prkg1	T	A	19: 30,571,638	T646S	probably benign	Het
Prr27	C	A	5: 87,843,135	P202Q	probably benign	Het
Prss16	C	A	13: 22,006,938	A206S	possibly damaging	Het
Prss37	A	T	6: 40,514,975	Y224N	probably damaging	Het
Ptprt	A	G	2: 161,575,778	L926S	probably benign	Het
Rgl1	G	A	1: 152,524,703	T649I	possibly damaging	Het
Rgs3	C	A	4: 62,640,782	D504E	probably benign	Het
Rpl9-ps1	T	A	11: 83,645,351	K91*	probably null	Het
Slc44a2	A	G	9: 21,341,972	Y65C	probably damaging	Het
Snw1	T	C	12: 87,458,904	K255E	probably damaging	Het
Sox6	T	C	7: 115,662,322	I220V	probably benign	Het
Synpo2	A	T	3: 123,080,056	I1146N	probably damaging	Het
Tas2r115	T	C	6: 132,737,509	R160G	probably benign	Het
Tchh	T	C	3: 93,446,744	F1164L	unknown	Het
Tmem110	T	A	14: 30,866,682	V122E	probably damaging	Het
Trim58	T	C	11: 58,651,267	V351A	probably damaging	Het
Ttf1	T	C	2: 29,074,654	S663P	possibly damaging	Het
Wdr59	A	G	8: 111,451,068	Y920H		Het
Zfp418	A	G	7: 7,182,436	Y466C	probably damaging	Het
Zfp827	A	T	8: 79,118,353	R717S	possibly damaging	Het

Other mutations in Rp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Rp1	APN	1	4346746	missense	probably damaging	0.98
IGL00593:Rp1	APN	1	4345403	missense	possibly damaging	0.70
IGL00956:Rp1	APN	1	4352212	missense	probably damaging	1.00
IGL01070:Rp1	APN	1	4345238	missense	probably damaging	1.00
IGL01531:Rp1	APN	1	4348945	missense	probably benign	0.00
IGL01668:Rp1	APN	1	4345718	missense	probably damaging	1.00
IGL01907:Rp1	APN	1	4348507	missense	possibly damaging	0.56
IGL02055:Rp1	APN	1	4352522	missense	probably damaging	1.00
IGL02071:Rp1	APN	1	4345310	missense	possibly damaging	0.46
IGL02128:Rp1	APN	1	4347385	missense	probably damaging	0.99
IGL02244:Rp1	APN	1	4348780	missense	probably benign	0.00
IGL02381:Rp1	APN	1	4352390	missense	probably benign	0.01
IGL02499:Rp1	APN	1	4349048	missense	probably benign	0.17
IGL02619:Rp1	APN	1	4348450	missense	possibly damaging	0.73
IGL02832:Rp1	APN	1	4349713	missense	probably benign	0.03
IGL02861:Rp1	APN	1	4346152	nonsense	probably null
IGL03288:Rp1	APN	1	4349524	missense	possibly damaging	0.88
IGL03290:Rp1	APN	1	4350041	missense	probably damaging	1.00
IGL03303:Rp1	APN	1	4344817	missense	probably damaging	1.00
R0041:Rp1	UTSW	1	4344628	missense	probably benign	0.36
R0111:Rp1	UTSW	1	4344760	missense	probably damaging	1.00
R0363:Rp1	UTSW	1	4347718	missense	probably damaging	1.00
R0440:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R0442:Rp1	UTSW	1	4346747	missense	probably benign	0.09
R0528:Rp1	UTSW	1	4344865	missense	possibly damaging	0.82
R0586:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R0639:Rp1	UTSW	1	4346498	missense	probably benign	0.00
R0856:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0908:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0968:Rp1	UTSW	1	4345352	missense	probably benign	0.00
R1099:Rp1	UTSW	1	4352290	missense	possibly damaging	0.45
R1242:Rp1	UTSW	1	4344962	missense	probably benign	0.03
R1301:Rp1	UTSW	1	4345936	missense	possibly damaging	0.56
R1327:Rp1	UTSW	1	4347970	missense	probably benign	0.01
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1440:Rp1	UTSW	1	4347396	missense	probably damaging	1.00
R1509:Rp1	UTSW	1	4347694	missense	probably damaging	0.98
R1509:Rp1	UTSW	1	4348537	missense	probably benign	0.20
R1538:Rp1	UTSW	1	4345676	missense	probably damaging	1.00
R1609:Rp1	UTSW	1	4349201	missense	probably damaging	1.00
R1666:Rp1	UTSW	1	4349863	missense	probably damaging	1.00
R1703:Rp1	UTSW	1	4345169	missense	probably damaging	1.00
R1782:Rp1	UTSW	1	4349089	missense	probably benign	0.00
R1799:Rp1	UTSW	1	4348832	missense	possibly damaging	0.94
R1848:Rp1	UTSW	1	4347232	missense	possibly damaging	0.76
R1908:Rp1	UTSW	1	4348720	missense	probably damaging	0.99
R1919:Rp1	UTSW	1	4352671	missense	probably damaging	0.99
R2087:Rp1	UTSW	1	4348352	missense	probably damaging	1.00
R2211:Rp1	UTSW	1	4348139	missense	probably damaging	0.96
R2278:Rp1	UTSW	1	4348027	missense	possibly damaging	0.51
R2287:Rp1	UTSW	1	4345959	nonsense	probably null
R2316:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R2346:Rp1	UTSW	1	4348013	missense	probably damaging	1.00
R2878:Rp1	UTSW	1	4348139	missense	probably damaging	1.00
R3023:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3025:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3716:Rp1	UTSW	1	4349765	missense	probably benign	0.38
R3814:Rp1	UTSW	1	4349708	missense	probably benign
R3929:Rp1	UTSW	1	4352645	missense	probably damaging	1.00
R4064:Rp1	UTSW	1	4345400	missense	probably benign	0.08
R4426:Rp1	UTSW	1	4347924	missense	probably benign	0.13
R4557:Rp1	UTSW	1	4344663	missense	possibly damaging	0.61
R4764:Rp1	UTSW	1	4345878	missense	probably damaging	0.96
R4845:Rp1	UTSW	1	4349228	missense	probably benign	0.02
R4850:Rp1	UTSW	1	4348675	missense	probably damaging	1.00
R4857:Rp1	UTSW	1	4352316	missense	probably damaging	0.99
R4857:Rp1	UTSW	1	4352317	missense	probably damaging	1.00
R5159:Rp1	UTSW	1	4346203	missense	possibly damaging	0.73
R5226:Rp1	UTSW	1	4348033	missense	probably benign	0.01
R5327:Rp1	UTSW	1	4349360	splice site	probably null
R5352:Rp1	UTSW	1	4347098	missense	probably benign	0.00
R5504:Rp1	UTSW	1	4349890	missense	probably damaging	1.00
R5527:Rp1	UTSW	1	4346393	missense	possibly damaging	0.75
R5529:Rp1	UTSW	1	4345832	missense	probably benign	0.42
R5569:Rp1	UTSW	1	4345237	missense	probably damaging	1.00
R5622:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R5970:Rp1	UTSW	1	4348462	missense	probably benign	0.05
R5992:Rp1	UTSW	1	4148703	missense	unknown
R6004:Rp1	UTSW	1	4197585	missense	unknown
R6018:Rp1	UTSW	1	4352836	missense	possibly damaging	0.83
R6074:Rp1	UTSW	1	4345379	missense	probably benign	0.02
R6127:Rp1	UTSW	1	4349311	missense	possibly damaging	0.80
R6187:Rp1	UTSW	1	4349869	missense	probably damaging	1.00
R6301:Rp1	UTSW	1	4347254	missense	probably benign	0.04
R6317:Rp1	UTSW	1	4041989	missense	unknown
R6405:Rp1	UTSW	1	4345771	missense	probably damaging	1.00
R6445:Rp1	UTSW	1	4226617	missense	unknown
R6466:Rp1	UTSW	1	4347886	missense	probably benign	0.01
R6501:Rp1	UTSW	1	4311280	intron	probably benign
R6547:Rp1	UTSW	1	4170305	missense	unknown
R6604:Rp1	UTSW	1	4019128	missense	unknown
R6700:Rp1	UTSW	1	4349896	missense	probably damaging	1.00
R6706:Rp1	UTSW	1	4142664	missense	unknown
R6831:Rp1	UTSW	1	4349864	splice site	probably null
R6918:Rp1	UTSW	1	3999608	missense	unknown
R6973:Rp1	UTSW	1	4351994	nonsense	probably null
R6981:Rp1	UTSW	1	4345655	missense	probably benign	0.06
R7009:Rp1	UTSW	1	4042068	missense	unknown
R7078:Rp1	UTSW	1	4206791	missense	unknown
R7112:Rp1	UTSW	1	4349018	missense	probably benign	0.43
R7135:Rp1	UTSW	1	4348168	missense	possibly damaging	0.83
R7165:Rp1	UTSW	1	4349917	missense	probably damaging	0.99
R7199:Rp1	UTSW	1	4347290	missense	possibly damaging	0.73
R7232:Rp1	UTSW	1	4228601	missense	unknown
R7367:Rp1	UTSW	1	4347998	missense	probably benign	0.42
R7484:Rp1	UTSW	1	4345481	missense	probably benign	0.10
R7500:Rp1	UTSW	1	4311278	missense	unknown
R7569:Rp1	UTSW	1	4284840	missense	unknown
R7642:Rp1	UTSW	1	4147831	missense	unknown
R7693:Rp1	UTSW	1	4347403	missense	probably damaging	1.00
R7742:Rp1	UTSW	1	4170234	missense	unknown
R7759:Rp1	UTSW	1	4344884	missense	probably benign
R7784:Rp1	UTSW	1	4142658	missense	unknown
R7816:Rp1	UTSW	1	4347703	missense	probably damaging	0.98
R7866:Rp1	UTSW	1	4347701	missense	probably benign	0.02
R8215:Rp1	UTSW	1	4245095	missense	unknown
R8281:Rp1	UTSW	1	4347916	missense	probably damaging	1.00
R8294:Rp1	UTSW	1	4345997	missense	probably benign	0.09
R8309:Rp1	UTSW	1	4347089	missense	probably benign	0.00
R8311:Rp1	UTSW	1	4348349	missense	probably benign	0.11
R8500:Rp1	UTSW	1	4346590	missense	possibly damaging	0.91
R8559:Rp1	UTSW	1	4349561	missense	probably damaging	1.00
R8672:Rp1	UTSW	1	4348784	missense	possibly damaging	0.55
R8688:Rp1	UTSW	1	4346405	missense	probably benign	0.01
R8792:Rp1	UTSW	1	4024868	missense	unknown
R8859:Rp1	UTSW	1	4349960	missense	probably benign	0.07
R8945:Rp1	UTSW	1	4349594	missense	probably benign	0.42
R8959:Rp1	UTSW	1	4349427	intron	probably benign
R8979:Rp1	UTSW	1	4148714	missense	unknown
R9126:Rp1	UTSW	1	4346913	missense	probably damaging	0.99
R9156:Rp1	UTSW	1	4163938	missense	unknown
R9160:Rp1	UTSW	1	4346497	missense	probably benign	0.00
R9221:Rp1	UTSW	1	4245043	missense	unknown
R9263:Rp1	UTSW	1	4348452	missense	probably benign	0.25
R9263:Rp1	UTSW	1	4348937	missense	probably benign	0.02
R9302:Rp1	UTSW	1	4346566	missense	probably damaging	1.00
R9414:Rp1	UTSW	1	4243618	missense	unknown
R9474:Rp1	UTSW	1	4092615	critical splice donor site	probably null
R9478:Rp1	UTSW	1	4347322	missense	probably benign	0.06
R9529:Rp1	UTSW	1	4346224	missense	probably benign
R9572:Rp1	UTSW	1	4348439	missense	probably benign
R9673:Rp1	UTSW	1	4267569	missense	unknown
R9709:Rp1	UTSW	1	4042032	missense	unknown
R9716:Rp1	UTSW	1	4142610	critical splice donor site	probably null
RF003:Rp1	UTSW	1	4344694	missense	probably damaging	0.99
V1662:Rp1	UTSW	1	4349560	missense	probably damaging	1.00
X0012:Rp1	UTSW	1	4347695	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTCCTAGAAAGCCATTGCGG -3'
(R):5'- TCGAAACTCTGTGAAAGTCATTTGG -3'

Sequencing Primer
(F):5'- GCCATTGCGGTTATAATTTACCAC -3'
(R):5'- GATCAGAAAGTTTTGCACAGACC -3'

Posted On

2022-03-25