Incidental Mutation 'R9318:Lamc1'
ID 705939
Institutional Source Beutler Lab
Gene Symbol Lamc1
Ensembl Gene ENSMUSG00000026478
Gene Name laminin, gamma 1
Synonyms laminin B2, Lamb2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9318 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 153094668-153208532 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 153127746 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 386 (R386S)
Ref Sequence ENSEMBL: ENSMUSP00000027752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027752]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027752
AA Change: R386S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: R386S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LamNT 42 282 1.97e-150 SMART
EGF_Lam 284 337 7.18e-7 SMART
EGF_Lam 340 393 7.93e-9 SMART
EGF_Lam 396 440 2.11e-13 SMART
EGF_Lam 443 490 2.87e-15 SMART
LamB 551 676 5.52e-48 SMART
Pfam:Laminin_EGF 683 718 1.3e-4 PFAM
EGF_Lam 722 768 2.38e-12 SMART
EGF_Lam 771 823 1.39e-4 SMART
EGF_Lam 826 879 8.05e-10 SMART
EGF_Lam 882 930 8.9e-12 SMART
EGF_Lam 933 978 1.26e-11 SMART
EGF_Lam 981 1026 7.4e-9 SMART
coiled coil region 1063 1594 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A G 15: 94,301,321 (GRCm39) S68P possibly damaging Het
Adcy6 A T 15: 98,491,466 (GRCm39) N1044K possibly damaging Het
Ak9 T G 10: 41,299,081 (GRCm39) M1594R unknown Het
Angpt1 A G 15: 42,301,751 (GRCm39) I419T probably benign Het
Ankrd31 A T 13: 97,015,085 (GRCm39) L1451F probably benign Het
Ap1b1 T C 11: 4,990,157 (GRCm39) I860T probably benign Het
Apc G A 18: 34,447,040 (GRCm39) R1312Q possibly damaging Het
Cadps2 A G 6: 23,496,887 (GRCm39) Y453H probably benign Het
Carmil2 A G 8: 106,414,486 (GRCm39) T148A probably benign Het
Ccdc125 A G 13: 100,832,920 (GRCm39) Y499C probably damaging Het
Ccdc14 A G 16: 34,525,288 (GRCm39) M194V possibly damaging Het
Ccdc162 C A 10: 41,506,110 (GRCm39) M893I probably benign Het
Ccdc33 C A 9: 57,993,876 (GRCm39) W335L possibly damaging Het
Chn2 T A 6: 54,272,840 (GRCm39) Y355N probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Clec4g A G 8: 3,766,500 (GRCm39) M267T probably damaging Het
Clybl G A 14: 122,608,815 (GRCm39) V136I probably damaging Het
Ctnnd1 G T 2: 84,438,682 (GRCm39) Q877K probably benign Het
Derl3 A G 10: 75,729,848 (GRCm39) K94R probably null Het
Dnah2 T C 11: 69,375,155 (GRCm39) E1356G probably benign Het
Dnah5 A C 15: 28,204,054 (GRCm39) probably benign Het
Dusp19 T A 2: 80,461,344 (GRCm39) V211E probably benign Het
Efcab3 T C 11: 104,856,648 (GRCm39) probably null Het
Entpd7 T A 19: 43,692,709 (GRCm39) V88E possibly damaging Het
Fam114a1 T A 5: 65,153,227 (GRCm39) S140T possibly damaging Het
Fbxw13 A G 9: 109,008,382 (GRCm39) F456L probably benign Het
Fpr-rs4 A T 17: 18,242,217 (GRCm39) M75L probably benign Het
Grb14 T G 2: 64,852,985 (GRCm39) T2P probably damaging Het
H2bc21 T C 3: 96,128,681 (GRCm39) V67A probably benign Het
Hace1 T A 10: 45,528,769 (GRCm39) S337T probably benign Het
Heatr5b C T 17: 79,072,831 (GRCm39) V1611I probably benign Het
Ints6 A T 14: 62,934,147 (GRCm39) S787T probably benign Het
Itga9 A G 9: 118,455,536 (GRCm39) K70R probably benign Het
Kcnt2 T C 1: 140,352,933 (GRCm39) I214T probably damaging Het
Kdelr3 C A 15: 79,411,275 (GRCm39) L203I probably benign Het
Kpnb1 A G 11: 97,054,284 (GRCm39) M842T probably benign Het
Lctl A G 9: 64,026,539 (GRCm39) probably benign Het
Lrrn3 G A 12: 41,503,243 (GRCm39) P358L probably damaging Het
Mag T C 7: 30,599,793 (GRCm39) H582R possibly damaging Het
Megf9 A T 4: 70,353,691 (GRCm39) C372S probably damaging Het
Mfsd11 T C 11: 116,750,398 (GRCm39) F139S probably damaging Het
Mpst G T 15: 78,294,642 (GRCm39) V125L probably damaging Het
Myo15b T C 11: 115,775,965 (GRCm39) V587A probably benign Het
Myod1 A T 7: 46,026,356 (GRCm39) H87L probably damaging Het
Oacyl G T 18: 65,858,415 (GRCm39) V247L probably benign Het
Or10ag54 A C 2: 87,099,271 (GRCm39) T49P possibly damaging Het
Or1j4 G A 2: 36,740,565 (GRCm39) C169Y probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or52ab7 T A 7: 102,978,583 (GRCm39) Y297N probably damaging Het
Or52e7 T C 7: 104,684,830 (GRCm39) Y142H probably damaging Het
Or5k14 A G 16: 58,692,748 (GRCm39) L255P probably damaging Het
Or5k17 A T 16: 58,746,271 (GRCm39) I221N probably damaging Het
Or6c6c A G 10: 129,541,283 (GRCm39) T179A probably benign Het
Or8b52 A G 9: 38,576,580 (GRCm39) S187P possibly damaging Het
Or8b57 A C 9: 40,004,112 (GRCm39) I50S possibly damaging Het
Pde3a T C 6: 141,425,202 (GRCm39) F666S probably benign Het
Phf20 G A 2: 156,115,690 (GRCm39) R337H probably benign Het
Plcg2 G A 8: 118,323,107 (GRCm39) E721K probably benign Het
Prkg1 T A 19: 30,549,038 (GRCm39) T646S probably benign Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Prss16 C A 13: 22,191,108 (GRCm39) A206S possibly damaging Het
Prss37 A T 6: 40,491,909 (GRCm39) Y224N probably damaging Het
Ptprt A G 2: 161,417,698 (GRCm39) L926S probably benign Het
Rgl1 G A 1: 152,400,454 (GRCm39) T649I possibly damaging Het
Rgs3 C A 4: 62,559,019 (GRCm39) D504E probably benign Het
Rp1 C T 1: 4,418,488 (GRCm39) A875T probably benign Het
Rpl9-ps1 T A 11: 83,536,177 (GRCm39) K91* probably null Het
Slc44a2 A G 9: 21,253,268 (GRCm39) Y65C probably damaging Het
Snw1 T C 12: 87,505,674 (GRCm39) K255E probably damaging Het
Sox6 T C 7: 115,261,557 (GRCm39) I220V probably benign Het
Stimate T A 14: 30,588,639 (GRCm39) V122E probably damaging Het
Synpo2 A T 3: 122,873,705 (GRCm39) I1146N probably damaging Het
Tas2r115 T C 6: 132,714,472 (GRCm39) R160G probably benign Het
Tchh T C 3: 93,354,051 (GRCm39) F1164L unknown Het
Trim58 T C 11: 58,542,093 (GRCm39) V351A probably damaging Het
Ttf1 T C 2: 28,964,666 (GRCm39) S663P possibly damaging Het
Wdr59 A G 8: 112,177,700 (GRCm39) Y920H Het
Zfp418 A G 7: 7,185,435 (GRCm39) Y466C probably damaging Het
Zfp827 A T 8: 79,844,982 (GRCm39) R717S possibly damaging Het
Other mutations in Lamc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Lamc1 APN 1 153,116,241 (GRCm39) missense probably damaging 1.00
IGL01397:Lamc1 APN 1 153,126,880 (GRCm39) missense probably damaging 1.00
IGL01661:Lamc1 APN 1 153,097,319 (GRCm39) missense possibly damaging 0.89
IGL01894:Lamc1 APN 1 153,122,828 (GRCm39) missense possibly damaging 0.51
IGL02000:Lamc1 APN 1 153,116,179 (GRCm39) missense probably damaging 1.00
IGL02649:Lamc1 APN 1 153,122,788 (GRCm39) missense possibly damaging 0.78
IGL02749:Lamc1 APN 1 153,125,599 (GRCm39) missense possibly damaging 0.51
IGL02819:Lamc1 APN 1 153,126,407 (GRCm39) missense probably damaging 1.00
IGL02831:Lamc1 APN 1 153,122,801 (GRCm39) missense probably benign 0.00
IGL03069:Lamc1 APN 1 153,115,127 (GRCm39) missense probably damaging 1.00
IGL03143:Lamc1 APN 1 153,208,020 (GRCm39) missense probably benign 0.00
IGL03166:Lamc1 APN 1 153,208,047 (GRCm39) missense probably benign 0.01
IGL03285:Lamc1 APN 1 153,103,431 (GRCm39) missense possibly damaging 0.96
IGL03294:Lamc1 APN 1 153,138,392 (GRCm39) missense probably damaging 1.00
pride UTSW 1 153,123,030 (GRCm39) missense probably benign 0.01
Stratum UTSW 1 153,126,870 (GRCm39) nonsense probably null
tier UTSW 1 153,126,268 (GRCm39) missense probably damaging 1.00
PIT4280001:Lamc1 UTSW 1 153,119,217 (GRCm39) missense probably damaging 1.00
R0003:Lamc1 UTSW 1 153,138,185 (GRCm39) missense probably damaging 0.99
R0003:Lamc1 UTSW 1 153,138,185 (GRCm39) missense probably damaging 0.99
R0027:Lamc1 UTSW 1 153,138,329 (GRCm39) missense probably damaging 1.00
R0060:Lamc1 UTSW 1 153,117,614 (GRCm39) unclassified probably benign
R0078:Lamc1 UTSW 1 153,104,936 (GRCm39) missense probably damaging 0.96
R0157:Lamc1 UTSW 1 153,138,353 (GRCm39) missense probably benign 0.00
R0282:Lamc1 UTSW 1 153,131,058 (GRCm39) missense probably benign
R0374:Lamc1 UTSW 1 153,126,811 (GRCm39) splice site probably benign
R0494:Lamc1 UTSW 1 153,122,682 (GRCm39) critical splice donor site probably null
R0502:Lamc1 UTSW 1 153,122,678 (GRCm39) splice site probably benign
R0755:Lamc1 UTSW 1 153,123,196 (GRCm39) missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153,110,341 (GRCm39) missense probably damaging 1.00
R0791:Lamc1 UTSW 1 153,110,326 (GRCm39) missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153,110,358 (GRCm39) missense probably benign 0.01
R0792:Lamc1 UTSW 1 153,110,326 (GRCm39) missense possibly damaging 0.94
R0792:Lamc1 UTSW 1 153,110,341 (GRCm39) missense probably damaging 1.00
R0792:Lamc1 UTSW 1 153,110,358 (GRCm39) missense probably benign 0.01
R0892:Lamc1 UTSW 1 153,208,000 (GRCm39) missense possibly damaging 0.95
R0941:Lamc1 UTSW 1 153,208,020 (GRCm39) missense possibly damaging 0.72
R0961:Lamc1 UTSW 1 153,097,446 (GRCm39) missense probably benign 0.03
R0961:Lamc1 UTSW 1 153,097,392 (GRCm39) frame shift probably null
R0963:Lamc1 UTSW 1 153,119,132 (GRCm39) missense probably benign
R1127:Lamc1 UTSW 1 153,126,205 (GRCm39) missense possibly damaging 0.69
R1173:Lamc1 UTSW 1 153,122,977 (GRCm39) splice site probably benign
R1175:Lamc1 UTSW 1 153,122,977 (GRCm39) splice site probably benign
R1449:Lamc1 UTSW 1 153,126,241 (GRCm39) missense probably benign
R1481:Lamc1 UTSW 1 153,097,380 (GRCm39) missense probably damaging 1.00
R1565:Lamc1 UTSW 1 153,118,489 (GRCm39) missense probably benign 0.34
R1583:Lamc1 UTSW 1 153,119,224 (GRCm39) critical splice acceptor site probably null
R1643:Lamc1 UTSW 1 153,133,818 (GRCm39) splice site probably benign
R1652:Lamc1 UTSW 1 153,125,392 (GRCm39) missense probably damaging 1.00
R1691:Lamc1 UTSW 1 153,122,995 (GRCm39) missense probably benign 0.04
R1854:Lamc1 UTSW 1 153,125,618 (GRCm39) missense probably damaging 0.99
R2018:Lamc1 UTSW 1 153,118,378 (GRCm39) missense probably benign 0.07
R2170:Lamc1 UTSW 1 153,124,888 (GRCm39) missense probably benign 0.07
R2410:Lamc1 UTSW 1 153,123,141 (GRCm39) missense possibly damaging 0.61
R3438:Lamc1 UTSW 1 153,102,161 (GRCm39) missense probably benign 0.04
R3615:Lamc1 UTSW 1 153,126,896 (GRCm39) missense probably damaging 1.00
R3616:Lamc1 UTSW 1 153,126,896 (GRCm39) missense probably damaging 1.00
R3699:Lamc1 UTSW 1 153,130,951 (GRCm39) missense possibly damaging 0.79
R3811:Lamc1 UTSW 1 153,138,454 (GRCm39) splice site probably null
R4285:Lamc1 UTSW 1 153,110,298 (GRCm39) missense probably damaging 0.99
R4431:Lamc1 UTSW 1 153,097,274 (GRCm39) missense probably damaging 1.00
R4579:Lamc1 UTSW 1 153,123,015 (GRCm39) missense probably damaging 1.00
R4625:Lamc1 UTSW 1 153,118,442 (GRCm39) missense probably benign 0.04
R4649:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4650:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4651:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4652:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4653:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4784:Lamc1 UTSW 1 153,107,486 (GRCm39) missense probably damaging 1.00
R4785:Lamc1 UTSW 1 153,107,486 (GRCm39) missense probably damaging 1.00
R4853:Lamc1 UTSW 1 153,104,846 (GRCm39) missense possibly damaging 0.89
R5216:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5217:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5218:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5219:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5468:Lamc1 UTSW 1 153,109,310 (GRCm39) missense probably damaging 0.99
R5597:Lamc1 UTSW 1 153,127,716 (GRCm39) missense probably damaging 1.00
R5754:Lamc1 UTSW 1 153,123,030 (GRCm39) missense probably benign 0.01
R6233:Lamc1 UTSW 1 153,099,412 (GRCm39) missense probably benign
R6431:Lamc1 UTSW 1 153,097,417 (GRCm39) missense probably benign 0.21
R6636:Lamc1 UTSW 1 153,117,721 (GRCm39) missense possibly damaging 0.93
R6888:Lamc1 UTSW 1 153,138,238 (GRCm39) missense probably damaging 1.00
R7161:Lamc1 UTSW 1 153,102,200 (GRCm39) missense probably damaging 1.00
R7240:Lamc1 UTSW 1 153,110,396 (GRCm39) missense possibly damaging 0.82
R7388:Lamc1 UTSW 1 153,124,822 (GRCm39) missense probably damaging 1.00
R7474:Lamc1 UTSW 1 153,208,011 (GRCm39) missense possibly damaging 0.81
R7570:Lamc1 UTSW 1 153,119,021 (GRCm39) missense possibly damaging 0.64
R7583:Lamc1 UTSW 1 153,118,978 (GRCm39) missense possibly damaging 0.71
R7597:Lamc1 UTSW 1 153,116,200 (GRCm39) missense possibly damaging 0.94
R7635:Lamc1 UTSW 1 153,124,806 (GRCm39) missense probably damaging 1.00
R7976:Lamc1 UTSW 1 153,123,014 (GRCm39) missense probably damaging 1.00
R8012:Lamc1 UTSW 1 153,097,358 (GRCm39) missense probably benign 0.04
R8207:Lamc1 UTSW 1 153,126,268 (GRCm39) missense probably damaging 1.00
R8219:Lamc1 UTSW 1 153,123,073 (GRCm39) missense probably damaging 1.00
R8227:Lamc1 UTSW 1 153,099,500 (GRCm39) missense probably benign 0.04
R8315:Lamc1 UTSW 1 153,119,167 (GRCm39) missense probably benign 0.00
R8417:Lamc1 UTSW 1 153,106,515 (GRCm39) missense probably damaging 1.00
R8685:Lamc1 UTSW 1 153,109,288 (GRCm39) missense probably benign 0.31
R8827:Lamc1 UTSW 1 153,097,424 (GRCm39) missense probably damaging 1.00
R8995:Lamc1 UTSW 1 153,207,993 (GRCm39) missense probably benign 0.00
R9061:Lamc1 UTSW 1 153,126,870 (GRCm39) nonsense probably null
R9141:Lamc1 UTSW 1 153,123,196 (GRCm39) missense probably benign 0.01
R9187:Lamc1 UTSW 1 153,097,434 (GRCm39) nonsense probably null
R9206:Lamc1 UTSW 1 153,126,197 (GRCm39) missense probably damaging 1.00
R9222:Lamc1 UTSW 1 153,119,087 (GRCm39) missense probably damaging 0.96
R9297:Lamc1 UTSW 1 153,127,746 (GRCm39) missense probably damaging 1.00
R9377:Lamc1 UTSW 1 153,115,009 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTAGAACAGCATACATCACGC -3'
(R):5'- TTCTATGCCATCTGTCATAGAGATG -3'

Sequencing Primer
(F):5'- GCCACACTTAACTCTGCACATG -3'
(R):5'- TTTCCCAATAAAGCACCCATGTTGG -3'
Posted On 2022-03-25