Incidental Mutation 'R9318:Ptprt'
ID 705947
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase, receptor type, T
Synonyms RPTPrho
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9318 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 161521990-162661147 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 161575778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 926 (L926S)
Ref Sequence ENSEMBL: ENSMUSP00000105067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109441
AA Change: L926S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: L926S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109442
AA Change: L945S

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: L945S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109443
AA Change: L936S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: L936S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109445
AA Change: L926S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: L926S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A G 15: 94,403,440 S68P possibly damaging Het
Adcy6 A T 15: 98,593,585 N1044K possibly damaging Het
Ak9 T G 10: 41,423,085 M1594R unknown Het
Angpt1 A G 15: 42,438,355 I419T probably benign Het
Ankrd31 A T 13: 96,878,577 L1451F probably benign Het
Ap1b1 T C 11: 5,040,157 I860T probably benign Het
Apc G A 18: 34,313,987 R1312Q possibly damaging Het
Cadps2 A G 6: 23,496,888 Y453H probably benign Het
Carmil2 A G 8: 105,687,854 T148A probably benign Het
Ccdc125 A G 13: 100,696,412 Y499C probably damaging Het
Ccdc14 A G 16: 34,704,918 M194V possibly damaging Het
Ccdc162 C A 10: 41,630,114 M893I probably benign Het
Ccdc33 C A 9: 58,086,593 W335L possibly damaging Het
Chn2 T A 6: 54,295,855 Y355N probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clec4g A G 8: 3,716,500 M267T probably damaging Het
Clybl G A 14: 122,371,403 V136I probably damaging Het
Ctnnd1 G T 2: 84,608,338 Q877K probably benign Het
Derl3 A G 10: 75,894,014 K94R probably null Het
Dnah2 T C 11: 69,484,329 E1356G probably benign Het
Dnah5 A C 15: 28,203,908 probably benign Het
Dusp19 T A 2: 80,631,000 V211E probably benign Het
Entpd7 T A 19: 43,704,270 V88E possibly damaging Het
Fam114a1 T A 5: 64,995,884 S140T possibly damaging Het
Fbxw13 A G 9: 109,179,314 F456L probably benign Het
Fpr-rs4 A T 17: 18,021,955 M75L probably benign Het
Gm11639 T C 11: 104,965,822 probably null Het
Grb14 T G 2: 65,022,641 T2P probably damaging Het
Hace1 T A 10: 45,652,673 S337T probably benign Het
Heatr5b C T 17: 78,765,402 V1611I probably benign Het
Hist2h2be T C 3: 96,221,365 V67A probably benign Het
Ints6 A T 14: 62,696,698 S787T probably benign Het
Itga9 A G 9: 118,626,468 K70R probably benign Het
Kcnt2 T C 1: 140,425,195 I214T probably damaging Het
Kdelr3 C A 15: 79,527,074 L203I probably benign Het
Kpnb1 A G 11: 97,163,458 M842T probably benign Het
Lamc1 G T 1: 153,252,000 R386S probably damaging Het
Lctl A G 9: 64,119,257 probably benign Het
Lrrn3 G A 12: 41,453,244 P358L probably damaging Het
Mag T C 7: 30,900,368 H582R possibly damaging Het
Megf9 A T 4: 70,435,454 C372S probably damaging Het
Mfsd11 T C 11: 116,859,572 F139S probably damaging Het
Mpst G T 15: 78,410,442 V125L probably damaging Het
Myo15b T C 11: 115,885,139 V587A probably benign Het
Myod1 A T 7: 46,376,932 H87L probably damaging Het
Oacyl G T 18: 65,725,344 V247L probably benign Het
Olfr1116 A C 2: 87,268,927 T49P possibly damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr177 A G 16: 58,872,385 L255P probably damaging Het
Olfr181 A T 16: 58,925,908 I221N probably damaging Het
Olfr350 G A 2: 36,850,553 C169Y probably benign Het
Olfr598 T A 7: 103,329,376 Y297N probably damaging Het
Olfr676 T C 7: 105,035,623 Y142H probably damaging Het
Olfr804 A G 10: 129,705,414 T179A probably benign Het
Olfr917 A G 9: 38,665,284 S187P possibly damaging Het
Olfr983 A C 9: 40,092,816 I50S possibly damaging Het
Pde3a T C 6: 141,479,476 F666S probably benign Het
Phf20 G A 2: 156,273,770 R337H probably benign Het
Plcg2 G A 8: 117,596,368 E721K probably benign Het
Prkg1 T A 19: 30,571,638 T646S probably benign Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Prss16 C A 13: 22,006,938 A206S possibly damaging Het
Prss37 A T 6: 40,514,975 Y224N probably damaging Het
Rgl1 G A 1: 152,524,703 T649I possibly damaging Het
Rgs3 C A 4: 62,640,782 D504E probably benign Het
Rp1 C T 1: 4,348,265 A875T probably benign Het
Rpl9-ps1 T A 11: 83,645,351 K91* probably null Het
Slc44a2 A G 9: 21,341,972 Y65C probably damaging Het
Snw1 T C 12: 87,458,904 K255E probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Synpo2 A T 3: 123,080,056 I1146N probably damaging Het
Tas2r115 T C 6: 132,737,509 R160G probably benign Het
Tchh T C 3: 93,446,744 F1164L unknown Het
Tmem110 T A 14: 30,866,682 V122E probably damaging Het
Trim58 T C 11: 58,651,267 V351A probably damaging Het
Ttf1 T C 2: 29,074,654 S663P possibly damaging Het
Wdr59 A G 8: 111,451,068 Y920H Het
Zfp418 A G 7: 7,182,436 Y466C probably damaging Het
Zfp827 A T 8: 79,118,353 R717S possibly damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161810624 missense probably benign 0.00
IGL00565:Ptprt APN 2 161560191 missense probably damaging 1.00
IGL00925:Ptprt APN 2 161656163 missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161551817 missense probably damaging 1.00
IGL01432:Ptprt APN 2 162268079 splice site probably benign
IGL02008:Ptprt APN 2 161927673 missense probably benign 0.02
IGL02040:Ptprt APN 2 162238072 missense probably damaging 1.00
IGL02172:Ptprt APN 2 161555502 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162238060 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162278046 critical splice donor site probably null
IGL02232:Ptprt APN 2 161530517 missense probably damaging 0.96
IGL02277:Ptprt APN 2 161547381 missense probably damaging 1.00
IGL02447:Ptprt APN 2 162278107 missense probably benign 0.01
IGL02601:Ptprt APN 2 161766307 missense probably benign 0.10
IGL02623:Ptprt APN 2 161607452 splice site probably benign
IGL03379:Ptprt APN 2 161555459 nonsense probably null
Poverina UTSW 2 161901497 missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161533613 missense probably damaging 0.96
R0064:Ptprt UTSW 2 161927791 splice site probably benign
R0129:Ptprt UTSW 2 162278070 missense probably benign 0.35
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0132:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0316:Ptprt UTSW 2 161607319 missense probably damaging 1.00
R0454:Ptprt UTSW 2 161553822 missense probably damaging 0.96
R0488:Ptprt UTSW 2 161553825 missense probably damaging 0.99
R0573:Ptprt UTSW 2 161551748 missense probably damaging 1.00
R0614:Ptprt UTSW 2 161812120 missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161812139 splice site probably null
R1023:Ptprt UTSW 2 161558943 missense probably damaging 1.00
R1184:Ptprt UTSW 2 161927772 missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162278226 missense probably damaging 1.00
R1476:Ptprt UTSW 2 161927484 missense probably damaging 1.00
R1515:Ptprt UTSW 2 162238034 missense probably damaging 1.00
R1595:Ptprt UTSW 2 161810549 critical splice donor site probably null
R1939:Ptprt UTSW 2 161927640 missense probably benign 0.45
R1987:Ptprt UTSW 2 161558898 missense probably damaging 1.00
R1987:Ptprt UTSW 2 161766321 missense possibly damaging 0.48
R2049:Ptprt UTSW 2 161534545 missense probably damaging 1.00
R2140:Ptprt UTSW 2 161811988 missense probably damaging 1.00
R2421:Ptprt UTSW 2 162278040 splice site probably benign
R3432:Ptprt UTSW 2 161927529 missense probably damaging 1.00
R3619:Ptprt UTSW 2 161566157 missense probably damaging 1.00
R3757:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3758:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3834:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3835:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3915:Ptprt UTSW 2 161555555 splice site probably benign
R4003:Ptprt UTSW 2 161566117 splice site probably benign
R4387:Ptprt UTSW 2 161927650 missense probably damaging 1.00
R4519:Ptprt UTSW 2 161564689 missense probably damaging 1.00
R4618:Ptprt UTSW 2 161553845 missense probably damaging 1.00
R4677:Ptprt UTSW 2 161901446 critical splice donor site probably null
R4866:Ptprt UTSW 2 161560239 missense probably damaging 1.00
R5088:Ptprt UTSW 2 162238175 missense probably benign 0.01
R5173:Ptprt UTSW 2 161927756 missense probably benign 0.01
R5215:Ptprt UTSW 2 162278164 missense probably damaging 1.00
R5383:Ptprt UTSW 2 161698049 missense probably damaging 1.00
R5398:Ptprt UTSW 2 161927592 missense probably damaging 1.00
R5518:Ptprt UTSW 2 162278223 missense probably damaging 0.99
R5711:Ptprt UTSW 2 161810604 missense probably damaging 0.98
R5735:Ptprt UTSW 2 161534564 missense probably damaging 0.98
R5834:Ptprt UTSW 2 161560269 missense probably damaging 1.00
R5872:Ptprt UTSW 2 162135218 missense probably damaging 1.00
R5926:Ptprt UTSW 2 161564686 missense probably benign 0.00
R6210:Ptprt UTSW 2 162268029 missense probably damaging 1.00
R6285:Ptprt UTSW 2 161901497 missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161553859 missense probably damaging 1.00
R6406:Ptprt UTSW 2 161553783 missense probably damaging 0.98
R6499:Ptprt UTSW 2 161534587 missense probably benign 0.32
R6613:Ptprt UTSW 2 161530447 missense probably damaging 1.00
R6622:Ptprt UTSW 2 161553840 missense probably damaging 1.00
R7218:Ptprt UTSW 2 161547364 missense probably damaging 1.00
R7247:Ptprt UTSW 2 161533523 missense probably benign 0.15
R7576:Ptprt UTSW 2 161607305 missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161575787 missense probably damaging 1.00
R7735:Ptprt UTSW 2 161575741 missense probably damaging 1.00
R7813:Ptprt UTSW 2 161530493 missense probably damaging 1.00
R8031:Ptprt UTSW 2 162135457 missense probably damaging 1.00
R8074:Ptprt UTSW 2 161927661 missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162278085 missense probably damaging 1.00
R8236:Ptprt UTSW 2 161687068 critical splice donor site probably null
R8308:Ptprt UTSW 2 161927646 missense probably benign 0.00
R8348:Ptprt UTSW 2 161558886 missense probably damaging 1.00
R8362:Ptprt UTSW 2 161551747 missense probably damaging 1.00
R8365:Ptprt UTSW 2 161901531 missense probably benign 0.05
R8448:Ptprt UTSW 2 161558886 missense probably damaging 1.00
R8512:Ptprt UTSW 2 161558863 missense probably benign 0.00
R8715:Ptprt UTSW 2 161530543 missense probably damaging 1.00
R9004:Ptprt UTSW 2 161766394 missense probably benign 0.04
R9046:Ptprt UTSW 2 161530441 missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161560186 missense probably damaging 1.00
R9297:Ptprt UTSW 2 161575778 missense probably benign
R9476:Ptprt UTSW 2 161555461 missense probably damaging 1.00
R9510:Ptprt UTSW 2 161555461 missense probably damaging 1.00
R9571:Ptprt UTSW 2 161553812 missense probably benign 0.10
X0064:Ptprt UTSW 2 161927483 missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162238121 missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 161732887 missense probably damaging 1.00
Z1177:Ptprt UTSW 2 162362948 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GAATGACTTCGCAGACAGACAC -3'
(R):5'- AGACCTGTTACCTCTCAGCACC -3'

Sequencing Primer
(F):5'- GGGATAAATACACCCCTTTGGACATG -3'
(R):5'- AGCACCTCTACTTCCTGATCTGTAG -3'
Posted On 2022-03-25