Incidental Mutation 'R0738:Olfr1454'
ID70595
Institutional Source Beutler Lab
Gene Symbol Olfr1454
Ensembl Gene ENSMUSG00000094986
Gene Nameolfactory receptor 1454
SynonymsMOR202-14, GA_x6K02T2RE5P-3390804-3391727
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13060610-13067157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13063738 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 109 (E109V)
Ref Sequence ENSEMBL: ENSMUSP00000148859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073732] [ENSMUST00000213806] [ENSMUST00000214695] [ENSMUST00000217568]
Predicted Effect probably damaging
Transcript: ENSMUST00000073732
AA Change: E109V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073409
Gene: ENSMUSG00000094986
AA Change: E109V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-50 PFAM
Pfam:7tm_1 39 288 2.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213806
AA Change: E109V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214695
AA Change: E109V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217568
AA Change: E109V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Olfr1454
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Olfr1454 APN 19 13064149 missense probably damaging 1.00
IGL02942:Olfr1454 APN 19 13064188 missense probably benign 0.45
IGL03331:Olfr1454 APN 19 13063867 missense probably damaging 1.00
R0551:Olfr1454 UTSW 19 13064294 missense probably benign 0.01
R1532:Olfr1454 UTSW 19 13064275 missense probably damaging 1.00
R2072:Olfr1454 UTSW 19 13063680 missense probably benign 0.00
R2092:Olfr1454 UTSW 19 13063802 nonsense probably null
R2656:Olfr1454 UTSW 19 13063984 missense probably benign 0.05
R2850:Olfr1454 UTSW 19 13063570 missense probably damaging 1.00
R4212:Olfr1454 UTSW 19 13063759 missense probably damaging 0.98
R5303:Olfr1454 UTSW 19 13063775 nonsense probably null
R6362:Olfr1454 UTSW 19 13063345 start gained probably benign
R6928:Olfr1454 UTSW 19 13063984 missense probably benign 0.05
R7183:Olfr1454 UTSW 19 13064316 missense probably benign 0.00
R7701:Olfr1454 UTSW 19 13064081 missense probably damaging 1.00
R7741:Olfr1454 UTSW 19 13064059 missense probably damaging 0.98
R8057:Olfr1454 UTSW 19 13063274 start gained probably benign
Z1176:Olfr1454 UTSW 19 13063646 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGGAAATCTTGGGCTGATCCTGTTG -3'
(R):5'- TGGACTACATTGGACTCACAGAAGGAG -3'

Sequencing Primer
(F):5'- TTGGATTCTCGGCTCCACAC -3'
(R):5'- CAGAAGGAGAGACTTAATGCATCTAC -3'
Posted On2013-09-30