Incidental Mutation 'R9318:Pde3a'
ID 705959
Institutional Source Beutler Lab
Gene Symbol Pde3a
Ensembl Gene ENSMUSG00000041741
Gene Name phosphodiesterase 3A, cGMP inhibited
Synonyms A930022O17Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.271) question?
Stock # R9318 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 141194995-141452588 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141425202 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 666 (F666S)
Ref Sequence ENSEMBL: ENSMUSP00000038749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043259]
AlphaFold Q9Z0X4
Predicted Effect probably benign
Transcript: ENSMUST00000043259
AA Change: F666S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: F666S

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 103 121 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
low complexity region 419 445 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
HDc 749 964 3.76e-4 SMART
low complexity region 1028 1056 N/A INTRINSIC
low complexity region 1114 1133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A G 15: 94,301,321 (GRCm39) S68P possibly damaging Het
Adcy6 A T 15: 98,491,466 (GRCm39) N1044K possibly damaging Het
Ak9 T G 10: 41,299,081 (GRCm39) M1594R unknown Het
Angpt1 A G 15: 42,301,751 (GRCm39) I419T probably benign Het
Ankrd31 A T 13: 97,015,085 (GRCm39) L1451F probably benign Het
Ap1b1 T C 11: 4,990,157 (GRCm39) I860T probably benign Het
Apc G A 18: 34,447,040 (GRCm39) R1312Q possibly damaging Het
Cadps2 A G 6: 23,496,887 (GRCm39) Y453H probably benign Het
Carmil2 A G 8: 106,414,486 (GRCm39) T148A probably benign Het
Ccdc125 A G 13: 100,832,920 (GRCm39) Y499C probably damaging Het
Ccdc14 A G 16: 34,525,288 (GRCm39) M194V possibly damaging Het
Ccdc162 C A 10: 41,506,110 (GRCm39) M893I probably benign Het
Ccdc33 C A 9: 57,993,876 (GRCm39) W335L possibly damaging Het
Chn2 T A 6: 54,272,840 (GRCm39) Y355N probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Clec4g A G 8: 3,766,500 (GRCm39) M267T probably damaging Het
Clybl G A 14: 122,608,815 (GRCm39) V136I probably damaging Het
Ctnnd1 G T 2: 84,438,682 (GRCm39) Q877K probably benign Het
Derl3 A G 10: 75,729,848 (GRCm39) K94R probably null Het
Dnah2 T C 11: 69,375,155 (GRCm39) E1356G probably benign Het
Dnah5 A C 15: 28,204,054 (GRCm39) probably benign Het
Dusp19 T A 2: 80,461,344 (GRCm39) V211E probably benign Het
Efcab3 T C 11: 104,856,648 (GRCm39) probably null Het
Entpd7 T A 19: 43,692,709 (GRCm39) V88E possibly damaging Het
Fam114a1 T A 5: 65,153,227 (GRCm39) S140T possibly damaging Het
Fbxw13 A G 9: 109,008,382 (GRCm39) F456L probably benign Het
Fpr-rs4 A T 17: 18,242,217 (GRCm39) M75L probably benign Het
Grb14 T G 2: 64,852,985 (GRCm39) T2P probably damaging Het
H2bc21 T C 3: 96,128,681 (GRCm39) V67A probably benign Het
Hace1 T A 10: 45,528,769 (GRCm39) S337T probably benign Het
Heatr5b C T 17: 79,072,831 (GRCm39) V1611I probably benign Het
Ints6 A T 14: 62,934,147 (GRCm39) S787T probably benign Het
Itga9 A G 9: 118,455,536 (GRCm39) K70R probably benign Het
Kcnt2 T C 1: 140,352,933 (GRCm39) I214T probably damaging Het
Kdelr3 C A 15: 79,411,275 (GRCm39) L203I probably benign Het
Kpnb1 A G 11: 97,054,284 (GRCm39) M842T probably benign Het
Lamc1 G T 1: 153,127,746 (GRCm39) R386S probably damaging Het
Lctl A G 9: 64,026,539 (GRCm39) probably benign Het
Lrrn3 G A 12: 41,503,243 (GRCm39) P358L probably damaging Het
Mag T C 7: 30,599,793 (GRCm39) H582R possibly damaging Het
Megf9 A T 4: 70,353,691 (GRCm39) C372S probably damaging Het
Mfsd11 T C 11: 116,750,398 (GRCm39) F139S probably damaging Het
Mpst G T 15: 78,294,642 (GRCm39) V125L probably damaging Het
Myo15b T C 11: 115,775,965 (GRCm39) V587A probably benign Het
Myod1 A T 7: 46,026,356 (GRCm39) H87L probably damaging Het
Oacyl G T 18: 65,858,415 (GRCm39) V247L probably benign Het
Or10ag54 A C 2: 87,099,271 (GRCm39) T49P possibly damaging Het
Or1j4 G A 2: 36,740,565 (GRCm39) C169Y probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or52ab7 T A 7: 102,978,583 (GRCm39) Y297N probably damaging Het
Or52e7 T C 7: 104,684,830 (GRCm39) Y142H probably damaging Het
Or5k14 A G 16: 58,692,748 (GRCm39) L255P probably damaging Het
Or5k17 A T 16: 58,746,271 (GRCm39) I221N probably damaging Het
Or6c6c A G 10: 129,541,283 (GRCm39) T179A probably benign Het
Or8b52 A G 9: 38,576,580 (GRCm39) S187P possibly damaging Het
Or8b57 A C 9: 40,004,112 (GRCm39) I50S possibly damaging Het
Phf20 G A 2: 156,115,690 (GRCm39) R337H probably benign Het
Plcg2 G A 8: 118,323,107 (GRCm39) E721K probably benign Het
Prkg1 T A 19: 30,549,038 (GRCm39) T646S probably benign Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Prss16 C A 13: 22,191,108 (GRCm39) A206S possibly damaging Het
Prss37 A T 6: 40,491,909 (GRCm39) Y224N probably damaging Het
Ptprt A G 2: 161,417,698 (GRCm39) L926S probably benign Het
Rgl1 G A 1: 152,400,454 (GRCm39) T649I possibly damaging Het
Rgs3 C A 4: 62,559,019 (GRCm39) D504E probably benign Het
Rp1 C T 1: 4,418,488 (GRCm39) A875T probably benign Het
Rpl9-ps1 T A 11: 83,536,177 (GRCm39) K91* probably null Het
Slc44a2 A G 9: 21,253,268 (GRCm39) Y65C probably damaging Het
Snw1 T C 12: 87,505,674 (GRCm39) K255E probably damaging Het
Sox6 T C 7: 115,261,557 (GRCm39) I220V probably benign Het
Stimate T A 14: 30,588,639 (GRCm39) V122E probably damaging Het
Synpo2 A T 3: 122,873,705 (GRCm39) I1146N probably damaging Het
Tas2r115 T C 6: 132,714,472 (GRCm39) R160G probably benign Het
Tchh T C 3: 93,354,051 (GRCm39) F1164L unknown Het
Trim58 T C 11: 58,542,093 (GRCm39) V351A probably damaging Het
Ttf1 T C 2: 28,964,666 (GRCm39) S663P possibly damaging Het
Wdr59 A G 8: 112,177,700 (GRCm39) Y920H Het
Zfp418 A G 7: 7,185,435 (GRCm39) Y466C probably damaging Het
Zfp827 A T 8: 79,844,982 (GRCm39) R717S possibly damaging Het
Other mutations in Pde3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Pde3a APN 6 141,405,464 (GRCm39) missense probably damaging 1.00
IGL01400:Pde3a APN 6 141,404,954 (GRCm39) missense probably benign 0.02
IGL01752:Pde3a APN 6 141,433,339 (GRCm39) splice site probably benign
IGL01819:Pde3a APN 6 141,433,263 (GRCm39) missense probably damaging 1.00
IGL02014:Pde3a APN 6 141,404,870 (GRCm39) missense probably null 1.00
IGL02119:Pde3a APN 6 141,405,529 (GRCm39) missense probably damaging 0.97
IGL02465:Pde3a APN 6 141,195,401 (GRCm39) missense possibly damaging 0.53
IGL02677:Pde3a APN 6 141,350,898 (GRCm39) splice site probably benign
IGL02961:Pde3a APN 6 141,405,426 (GRCm39) nonsense probably null
IGL03034:Pde3a APN 6 141,438,126 (GRCm39) splice site probably benign
IGL03142:Pde3a APN 6 141,438,025 (GRCm39) missense probably benign 0.01
PIT4305001:Pde3a UTSW 6 141,438,036 (GRCm39) missense probably benign 0.04
R0412:Pde3a UTSW 6 141,444,410 (GRCm39) missense probably damaging 1.00
R0517:Pde3a UTSW 6 141,444,383 (GRCm39) nonsense probably null
R0573:Pde3a UTSW 6 141,437,957 (GRCm39) missense probably damaging 1.00
R0621:Pde3a UTSW 6 141,195,725 (GRCm39) missense probably damaging 1.00
R0781:Pde3a UTSW 6 141,405,042 (GRCm39) splice site probably benign
R1065:Pde3a UTSW 6 141,422,458 (GRCm39) splice site probably benign
R1110:Pde3a UTSW 6 141,405,042 (GRCm39) splice site probably benign
R1462:Pde3a UTSW 6 141,405,560 (GRCm39) missense probably benign 0.05
R1462:Pde3a UTSW 6 141,405,560 (GRCm39) missense probably benign 0.05
R1470:Pde3a UTSW 6 141,411,932 (GRCm39) missense probably benign 0.41
R1470:Pde3a UTSW 6 141,411,932 (GRCm39) missense probably benign 0.41
R1480:Pde3a UTSW 6 141,433,300 (GRCm39) missense probably benign 0.17
R1559:Pde3a UTSW 6 141,404,824 (GRCm39) missense probably damaging 1.00
R1862:Pde3a UTSW 6 141,433,239 (GRCm39) missense probably damaging 1.00
R1862:Pde3a UTSW 6 141,196,079 (GRCm39) missense probably damaging 1.00
R1902:Pde3a UTSW 6 141,444,496 (GRCm39) missense probably benign
R1909:Pde3a UTSW 6 141,195,965 (GRCm39) missense probably benign 0.00
R2048:Pde3a UTSW 6 141,434,732 (GRCm39) splice site probably benign
R2144:Pde3a UTSW 6 141,435,837 (GRCm39) missense probably benign 0.40
R2155:Pde3a UTSW 6 141,429,640 (GRCm39) missense possibly damaging 0.70
R2208:Pde3a UTSW 6 141,196,073 (GRCm39) missense probably damaging 0.97
R2405:Pde3a UTSW 6 141,426,968 (GRCm39) missense probably damaging 1.00
R4592:Pde3a UTSW 6 141,404,942 (GRCm39) missense probably benign 0.13
R4677:Pde3a UTSW 6 141,411,865 (GRCm39) missense probably benign 0.02
R4803:Pde3a UTSW 6 141,404,812 (GRCm39) missense probably damaging 1.00
R4887:Pde3a UTSW 6 141,416,668 (GRCm39) missense possibly damaging 0.94
R4999:Pde3a UTSW 6 141,195,751 (GRCm39) missense probably benign 0.00
R5055:Pde3a UTSW 6 141,433,682 (GRCm39) nonsense probably null
R5181:Pde3a UTSW 6 141,426,981 (GRCm39) critical splice donor site probably null
R5640:Pde3a UTSW 6 141,429,641 (GRCm39) missense probably damaging 0.99
R5694:Pde3a UTSW 6 141,196,228 (GRCm39) missense possibly damaging 0.48
R6176:Pde3a UTSW 6 141,444,615 (GRCm39) missense possibly damaging 0.96
R6394:Pde3a UTSW 6 141,433,237 (GRCm39) missense probably damaging 1.00
R6692:Pde3a UTSW 6 141,425,072 (GRCm39) missense probably damaging 1.00
R6968:Pde3a UTSW 6 141,433,658 (GRCm39) missense probably damaging 1.00
R7137:Pde3a UTSW 6 141,444,472 (GRCm39) missense probably benign 0.26
R7163:Pde3a UTSW 6 141,433,270 (GRCm39) missense probably damaging 1.00
R7677:Pde3a UTSW 6 141,195,983 (GRCm39) missense probably damaging 1.00
R7754:Pde3a UTSW 6 141,404,975 (GRCm39) missense probably benign 0.32
R8037:Pde3a UTSW 6 141,429,650 (GRCm39) missense possibly damaging 0.82
R8123:Pde3a UTSW 6 141,411,917 (GRCm39) missense probably benign 0.00
R8206:Pde3a UTSW 6 141,433,611 (GRCm39) missense probably damaging 1.00
R8262:Pde3a UTSW 6 141,433,527 (GRCm39) missense possibly damaging 0.89
R8376:Pde3a UTSW 6 141,426,947 (GRCm39) missense possibly damaging 0.50
R8893:Pde3a UTSW 6 141,405,522 (GRCm39) missense probably damaging 1.00
R9037:Pde3a UTSW 6 141,416,832 (GRCm39) missense probably damaging 1.00
R9158:Pde3a UTSW 6 141,195,614 (GRCm39) missense probably benign
R9222:Pde3a UTSW 6 141,437,904 (GRCm39) missense probably damaging 1.00
R9385:Pde3a UTSW 6 141,437,982 (GRCm39) missense probably benign 0.30
X0053:Pde3a UTSW 6 141,429,695 (GRCm39) splice site probably null
X0062:Pde3a UTSW 6 141,195,710 (GRCm39) missense probably damaging 1.00
Z1177:Pde3a UTSW 6 141,196,195 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGGAGGGCTTACTTCCTTGC -3'
(R):5'- TCACTACCAAGTAAAGGCATCATG -3'

Sequencing Primer
(F):5'- CCCCATCTCTTATAACAGGCC -3'
(R):5'- GGCATCATGAAGAAACCAAGATACTC -3'
Posted On 2022-03-25