Incidental Mutation 'R0738:Ch25h'
ID70596
Institutional Source Beutler Lab
Gene Symbol Ch25h
Ensembl Gene ENSMUSG00000050370
Gene Namecholesterol 25-hydroxylase
Synonymsm25OH
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34473786-34475135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34474387 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 247 (N247S)
Ref Sequence ENSEMBL: ENSMUSP00000049683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050562]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050562
AA Change: N247S

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049683
Gene: ENSMUSG00000050370
AA Change: N247S

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
Pfam:FA_hydroxylase 128 263 3.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181777
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This is an intronless gene that is involved in cholesterol and lipid metabolism. The encoded protein is a membrane protein and contains clusters of histidine residues essential for catalytic activity. Unlike most other sterol hydroxylases, this enzyme is a member of a small family of enzymes that utilize diiron cofactors to catalyze the hydroxylation of hydrophobic substrates. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased IgG2a and IgA in the sera, lungs, and intestinal mucosa and increased IgG2b and IgG3 in the intestinal mucosa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Ch25h
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1711:Ch25h UTSW 19 34474286 missense probably benign
R2177:Ch25h UTSW 19 34474697 missense probably damaging 1.00
R2869:Ch25h UTSW 19 34474810 missense probably benign 0.03
R2873:Ch25h UTSW 19 34474810 missense probably benign 0.03
R5558:Ch25h UTSW 19 34474463 missense probably damaging 1.00
R6173:Ch25h UTSW 19 34474496 missense probably damaging 1.00
R8313:Ch25h UTSW 19 34474738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGCTGAATGTCTACCTTGTGTCCTG -3'
(R):5'- TGACCTTCTTCGACGTGCTGAAC -3'

Sequencing Primer
(F):5'- TGTCCTGGAGTCAATGACAC -3'
(R):5'- GACGTGCTGAACGTCGC -3'
Posted On2013-09-30