Incidental Mutation 'R9318:Mag'
ID 705961
Institutional Source Beutler Lab
Gene Symbol Mag
Ensembl Gene ENSMUSG00000036634
Gene Name myelin-associated glycoprotein
Synonyms Gma, siglec-4a
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9318 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30598601-30614298 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30599793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 582 (H582R)
Ref Sequence ENSEMBL: ENSMUSP00000139564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040548] [ENSMUST00000187137] [ENSMUST00000188569] [ENSMUST00000191081]
AlphaFold P20917
Predicted Effect possibly damaging
Transcript: ENSMUST00000040548
AA Change: H582R

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041464
Gene: ENSMUSG00000036634
AA Change: H582R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187137
AA Change: H582R

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139564
Gene: ENSMUSG00000036634
AA Change: H582R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188569
SMART Domains Protein: ENSMUSP00000140526
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
Blast:IG 152 195 1e-19 BLAST
IGc2 210 270 5.74e-13 SMART
IGc2 296 357 7.64e-9 SMART
transmembrane domain 469 491 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191081
SMART Domains Protein: ENSMUSP00000139881
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 6.7e-3 SMART
IG 144 237 1.8e-2 SMART
IGc2 252 312 2.4e-15 SMART
IGc2 338 399 3e-11 SMART
transmembrane domain 511 533 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
Meta Mutation Damage Score 0.1234 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: This gene encodes a type I membrane protein and member of the immunoglobulin-like superfamily. It is expressed in myelinating glial cells, including oligodendrocytes of the central nervous system and Schwann cells of the peripheral nervous system. Mice lacking the encoded protein express abundant myelin, but suffer long-term axon degeneration, altered distribution of channels and adhesion molecules at nodes of Ranvier, and altered axon cytoskeletal structure. While not required for myelination, the encoded protein enhances axon-myelin stability, helps to structure nodes of Ranvier, and regulates the axon cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed CNS myelination, late myelin degeneration in peripheral nerves, hypomyelination of optic nerves, and subtle intention tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A G 15: 94,301,321 (GRCm39) S68P possibly damaging Het
Adcy6 A T 15: 98,491,466 (GRCm39) N1044K possibly damaging Het
Ak9 T G 10: 41,299,081 (GRCm39) M1594R unknown Het
Angpt1 A G 15: 42,301,751 (GRCm39) I419T probably benign Het
Ankrd31 A T 13: 97,015,085 (GRCm39) L1451F probably benign Het
Ap1b1 T C 11: 4,990,157 (GRCm39) I860T probably benign Het
Apc G A 18: 34,447,040 (GRCm39) R1312Q possibly damaging Het
Cadps2 A G 6: 23,496,887 (GRCm39) Y453H probably benign Het
Carmil2 A G 8: 106,414,486 (GRCm39) T148A probably benign Het
Ccdc125 A G 13: 100,832,920 (GRCm39) Y499C probably damaging Het
Ccdc14 A G 16: 34,525,288 (GRCm39) M194V possibly damaging Het
Ccdc162 C A 10: 41,506,110 (GRCm39) M893I probably benign Het
Ccdc33 C A 9: 57,993,876 (GRCm39) W335L possibly damaging Het
Chn2 T A 6: 54,272,840 (GRCm39) Y355N probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Clec4g A G 8: 3,766,500 (GRCm39) M267T probably damaging Het
Clybl G A 14: 122,608,815 (GRCm39) V136I probably damaging Het
Ctnnd1 G T 2: 84,438,682 (GRCm39) Q877K probably benign Het
Derl3 A G 10: 75,729,848 (GRCm39) K94R probably null Het
Dnah2 T C 11: 69,375,155 (GRCm39) E1356G probably benign Het
Dnah5 A C 15: 28,204,054 (GRCm39) probably benign Het
Dusp19 T A 2: 80,461,344 (GRCm39) V211E probably benign Het
Efcab3 T C 11: 104,856,648 (GRCm39) probably null Het
Entpd7 T A 19: 43,692,709 (GRCm39) V88E possibly damaging Het
Fam114a1 T A 5: 65,153,227 (GRCm39) S140T possibly damaging Het
Fbxw13 A G 9: 109,008,382 (GRCm39) F456L probably benign Het
Fpr-rs4 A T 17: 18,242,217 (GRCm39) M75L probably benign Het
Grb14 T G 2: 64,852,985 (GRCm39) T2P probably damaging Het
H2bc21 T C 3: 96,128,681 (GRCm39) V67A probably benign Het
Hace1 T A 10: 45,528,769 (GRCm39) S337T probably benign Het
Heatr5b C T 17: 79,072,831 (GRCm39) V1611I probably benign Het
Ints6 A T 14: 62,934,147 (GRCm39) S787T probably benign Het
Itga9 A G 9: 118,455,536 (GRCm39) K70R probably benign Het
Kcnt2 T C 1: 140,352,933 (GRCm39) I214T probably damaging Het
Kdelr3 C A 15: 79,411,275 (GRCm39) L203I probably benign Het
Kpnb1 A G 11: 97,054,284 (GRCm39) M842T probably benign Het
Lamc1 G T 1: 153,127,746 (GRCm39) R386S probably damaging Het
Lctl A G 9: 64,026,539 (GRCm39) probably benign Het
Lrrn3 G A 12: 41,503,243 (GRCm39) P358L probably damaging Het
Megf9 A T 4: 70,353,691 (GRCm39) C372S probably damaging Het
Mfsd11 T C 11: 116,750,398 (GRCm39) F139S probably damaging Het
Mpst G T 15: 78,294,642 (GRCm39) V125L probably damaging Het
Myo15b T C 11: 115,775,965 (GRCm39) V587A probably benign Het
Myod1 A T 7: 46,026,356 (GRCm39) H87L probably damaging Het
Oacyl G T 18: 65,858,415 (GRCm39) V247L probably benign Het
Or10ag54 A C 2: 87,099,271 (GRCm39) T49P possibly damaging Het
Or1j4 G A 2: 36,740,565 (GRCm39) C169Y probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or52ab7 T A 7: 102,978,583 (GRCm39) Y297N probably damaging Het
Or52e7 T C 7: 104,684,830 (GRCm39) Y142H probably damaging Het
Or5k14 A G 16: 58,692,748 (GRCm39) L255P probably damaging Het
Or5k17 A T 16: 58,746,271 (GRCm39) I221N probably damaging Het
Or6c6c A G 10: 129,541,283 (GRCm39) T179A probably benign Het
Or8b52 A G 9: 38,576,580 (GRCm39) S187P possibly damaging Het
Or8b57 A C 9: 40,004,112 (GRCm39) I50S possibly damaging Het
Pde3a T C 6: 141,425,202 (GRCm39) F666S probably benign Het
Phf20 G A 2: 156,115,690 (GRCm39) R337H probably benign Het
Plcg2 G A 8: 118,323,107 (GRCm39) E721K probably benign Het
Prkg1 T A 19: 30,549,038 (GRCm39) T646S probably benign Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Prss16 C A 13: 22,191,108 (GRCm39) A206S possibly damaging Het
Prss37 A T 6: 40,491,909 (GRCm39) Y224N probably damaging Het
Ptprt A G 2: 161,417,698 (GRCm39) L926S probably benign Het
Rgl1 G A 1: 152,400,454 (GRCm39) T649I possibly damaging Het
Rgs3 C A 4: 62,559,019 (GRCm39) D504E probably benign Het
Rp1 C T 1: 4,418,488 (GRCm39) A875T probably benign Het
Rpl9-ps1 T A 11: 83,536,177 (GRCm39) K91* probably null Het
Slc44a2 A G 9: 21,253,268 (GRCm39) Y65C probably damaging Het
Snw1 T C 12: 87,505,674 (GRCm39) K255E probably damaging Het
Sox6 T C 7: 115,261,557 (GRCm39) I220V probably benign Het
Stimate T A 14: 30,588,639 (GRCm39) V122E probably damaging Het
Synpo2 A T 3: 122,873,705 (GRCm39) I1146N probably damaging Het
Tas2r115 T C 6: 132,714,472 (GRCm39) R160G probably benign Het
Tchh T C 3: 93,354,051 (GRCm39) F1164L unknown Het
Trim58 T C 11: 58,542,093 (GRCm39) V351A probably damaging Het
Ttf1 T C 2: 28,964,666 (GRCm39) S663P possibly damaging Het
Wdr59 A G 8: 112,177,700 (GRCm39) Y920H Het
Zfp418 A G 7: 7,185,435 (GRCm39) Y466C probably damaging Het
Zfp827 A T 8: 79,844,982 (GRCm39) R717S possibly damaging Het
Other mutations in Mag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Mag APN 7 30,599,812 (GRCm39) missense probably benign 0.00
IGL02036:Mag APN 7 30,607,877 (GRCm39) missense probably damaging 0.97
IGL03263:Mag APN 7 30,598,953 (GRCm39) splice site probably null
regie UTSW 7 30,600,154 (GRCm39) missense probably damaging 0.98
R0005:Mag UTSW 7 30,607,779 (GRCm39) splice site probably benign
R0403:Mag UTSW 7 30,606,405 (GRCm39) missense probably damaging 1.00
R1590:Mag UTSW 7 30,601,277 (GRCm39) missense probably damaging 0.99
R1874:Mag UTSW 7 30,608,476 (GRCm39) missense probably benign 0.13
R2170:Mag UTSW 7 30,608,412 (GRCm39) nonsense probably null
R2192:Mag UTSW 7 30,600,066 (GRCm39) nonsense probably null
R3176:Mag UTSW 7 30,601,073 (GRCm39) critical splice donor site probably null
R3177:Mag UTSW 7 30,601,073 (GRCm39) critical splice donor site probably null
R3276:Mag UTSW 7 30,601,073 (GRCm39) critical splice donor site probably null
R3277:Mag UTSW 7 30,601,073 (GRCm39) critical splice donor site probably null
R4540:Mag UTSW 7 30,600,154 (GRCm39) missense probably damaging 0.98
R4635:Mag UTSW 7 30,606,348 (GRCm39) missense probably damaging 1.00
R4704:Mag UTSW 7 30,608,598 (GRCm39) missense probably damaging 1.00
R4891:Mag UTSW 7 30,599,793 (GRCm39) missense possibly damaging 0.77
R4940:Mag UTSW 7 30,608,625 (GRCm39) missense probably damaging 1.00
R4952:Mag UTSW 7 30,608,581 (GRCm39) nonsense probably null
R6301:Mag UTSW 7 30,600,104 (GRCm39) missense probably damaging 1.00
R6441:Mag UTSW 7 30,606,508 (GRCm39) missense possibly damaging 0.65
R6951:Mag UTSW 7 30,610,858 (GRCm39) missense possibly damaging 0.89
R7562:Mag UTSW 7 30,608,559 (GRCm39) missense possibly damaging 0.83
R8312:Mag UTSW 7 30,610,894 (GRCm39) missense probably damaging 1.00
X0024:Mag UTSW 7 30,606,496 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTGGACACACAATAGGGC -3'
(R):5'- GCCAGACTCATGGGTGTTTG -3'

Sequencing Primer
(F):5'- CACACAATAGGGCAGTGGC -3'
(R):5'- CCAGACTCATGGGTGTTTGTAGGG -3'
Posted On 2022-03-25