Incidental Mutation 'R9318:Ccdc33'
ID 705974
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Name coiled-coil domain containing 33
Synonyms LOC382077, 4930535E21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9318 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 58028677-58118823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 58086593 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 335 (W335L)
Ref Sequence ENSEMBL: ENSMUSP00000096279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000128021] [ENSMUST00000136154] [ENSMUST00000215944]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042205
AA Change: W90L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: W90L

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098682
AA Change: W335L

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: W335L

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119665
AA Change: W90L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: W90L

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128021
SMART Domains Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 87 8.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136154
SMART Domains Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 199 1.7e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215944
AA Change: W335L

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A G 15: 94,403,440 S68P possibly damaging Het
Adcy6 A T 15: 98,593,585 N1044K possibly damaging Het
Ak9 T G 10: 41,423,085 M1594R unknown Het
Angpt1 A G 15: 42,438,355 I419T probably benign Het
Ankrd31 A T 13: 96,878,577 L1451F probably benign Het
Ap1b1 T C 11: 5,040,157 I860T probably benign Het
Apc G A 18: 34,313,987 R1312Q possibly damaging Het
Cadps2 A G 6: 23,496,888 Y453H probably benign Het
Carmil2 A G 8: 105,687,854 T148A probably benign Het
Ccdc125 A G 13: 100,696,412 Y499C probably damaging Het
Ccdc14 A G 16: 34,704,918 M194V possibly damaging Het
Ccdc162 C A 10: 41,630,114 M893I probably benign Het
Chn2 T A 6: 54,295,855 Y355N probably damaging Het
Clec4g A G 8: 3,716,500 M267T probably damaging Het
Clybl G A 14: 122,371,403 V136I probably damaging Het
Ctnnd1 G T 2: 84,608,338 Q877K probably benign Het
Derl3 A G 10: 75,894,014 K94R probably null Het
Dnah2 T C 11: 69,484,329 E1356G probably benign Het
Dnah5 A C 15: 28,203,908 probably benign Het
Dusp19 T A 2: 80,631,000 V211E probably benign Het
Entpd7 T A 19: 43,704,270 V88E possibly damaging Het
Fam114a1 T A 5: 64,995,884 S140T possibly damaging Het
Fbxw13 A G 9: 109,179,314 F456L probably benign Het
Fpr-rs4 A T 17: 18,021,955 M75L probably benign Het
Gm11639 T C 11: 104,965,822 probably null Het
Grb14 T G 2: 65,022,641 T2P probably damaging Het
Hace1 T A 10: 45,652,673 S337T probably benign Het
Heatr5b C T 17: 78,765,402 V1611I probably benign Het
Hist2h2be T C 3: 96,221,365 V67A probably benign Het
Ints6 A T 14: 62,696,698 S787T probably benign Het
Itga9 A G 9: 118,626,468 K70R probably benign Het
Kcnt2 T C 1: 140,425,195 I214T probably damaging Het
Kdelr3 C A 15: 79,527,074 L203I probably benign Het
Kpnb1 A G 11: 97,163,458 M842T probably benign Het
Lamc1 G T 1: 153,252,000 R386S probably damaging Het
Lrrn3 G A 12: 41,453,244 P358L probably damaging Het
Mag T C 7: 30,900,368 H582R possibly damaging Het
Megf9 A T 4: 70,435,454 C372S probably damaging Het
Mfsd11 T C 11: 116,859,572 F139S probably damaging Het
Mpst G T 15: 78,410,442 V125L probably damaging Het
Myo15b T C 11: 115,885,139 V587A probably benign Het
Myod1 A T 7: 46,376,932 H87L probably damaging Het
Oacyl G T 18: 65,725,344 V247L probably benign Het
Olfr1116 A C 2: 87,268,927 T49P possibly damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr177 A G 16: 58,872,385 L255P probably damaging Het
Olfr181 A T 16: 58,925,908 I221N probably damaging Het
Olfr350 G A 2: 36,850,553 C169Y probably benign Het
Olfr598 T A 7: 103,329,376 Y297N probably damaging Het
Olfr676 T C 7: 105,035,623 Y142H probably damaging Het
Olfr804 A G 10: 129,705,414 T179A probably benign Het
Olfr917 A G 9: 38,665,284 S187P possibly damaging Het
Olfr983 A C 9: 40,092,816 I50S possibly damaging Het
Pde3a T C 6: 141,479,476 F666S probably benign Het
Phf20 G A 2: 156,273,770 R337H probably benign Het
Plcg2 G A 8: 117,596,368 E721K probably benign Het
Prkg1 T A 19: 30,571,638 T646S probably benign Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Prss16 C A 13: 22,006,938 A206S possibly damaging Het
Prss37 A T 6: 40,514,975 Y224N probably damaging Het
Ptprt A G 2: 161,575,778 L926S probably benign Het
Rgl1 G A 1: 152,524,703 T649I possibly damaging Het
Rgs3 C A 4: 62,640,782 D504E probably benign Het
Rp1 C T 1: 4,348,265 A875T probably benign Het
Rpl9-ps1 T A 11: 83,645,351 K91* probably null Het
Slc44a2 A G 9: 21,341,972 Y65C probably damaging Het
Snw1 T C 12: 87,458,904 K255E probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Synpo2 A T 3: 123,080,056 I1146N probably damaging Het
Tas2r115 T C 6: 132,737,509 R160G probably benign Het
Tchh T C 3: 93,446,744 F1164L unknown Het
Tmem110 T A 14: 30,866,682 V122E probably damaging Het
Trim58 T C 11: 58,651,267 V351A probably damaging Het
Ttf1 T C 2: 29,074,654 S663P possibly damaging Het
Wdr59 A G 8: 111,451,068 Y920H Het
Zfp418 A G 7: 7,182,436 Y466C probably damaging Het
Zfp827 A T 8: 79,118,353 R717S possibly damaging Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 58082048 missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58117214 splice site probably benign
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 58033672 missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R3899:Ccdc33 UTSW 9 58032917 missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4468:Ccdc33 UTSW 9 58069872 missense possibly damaging 0.67
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 splice site probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
R7655:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7868:Ccdc33 UTSW 9 58069091 missense probably benign
R8215:Ccdc33 UTSW 9 58032712 missense probably benign 0.18
R9139:Ccdc33 UTSW 9 58076559 missense probably benign 0.04
R9204:Ccdc33 UTSW 9 58031105 missense probably benign 0.33
R9280:Ccdc33 UTSW 9 58058266 missense probably benign
R9297:Ccdc33 UTSW 9 58086593 missense possibly damaging 0.85
R9361:Ccdc33 UTSW 9 58117625 missense possibly damaging 0.96
RF003:Ccdc33 UTSW 9 58058291 missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58117416 missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58118585 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TAAATGCTTTTATCGGAGCCCAG -3'
(R):5'- GCATCCATTAAGCCCAGGAC -3'

Sequencing Primer
(F):5'- CTTTTATCGGAGCCCAGGGAGG -3'
(R):5'- TTAAGCCCAGGACGACATG -3'
Posted On 2022-03-25