Incidental Mutation 'R9318:Ccdc33'
ID 705974
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Name coiled-coil domain containing 33
Synonyms LOC382077, 4930535E21Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9318 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 57935960-58026106 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 57993876 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 335 (W335L)
Ref Sequence ENSEMBL: ENSMUSP00000096279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000128021] [ENSMUST00000136154] [ENSMUST00000215944]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042205
AA Change: W90L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: W90L

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098682
AA Change: W335L

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: W335L

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119665
AA Change: W90L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: W90L

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128021
SMART Domains Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 87 8.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136154
SMART Domains Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 199 1.7e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215944
AA Change: W335L

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.3663 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A G 15: 94,301,321 (GRCm39) S68P possibly damaging Het
Adcy6 A T 15: 98,491,466 (GRCm39) N1044K possibly damaging Het
Ak9 T G 10: 41,299,081 (GRCm39) M1594R unknown Het
Angpt1 A G 15: 42,301,751 (GRCm39) I419T probably benign Het
Ankrd31 A T 13: 97,015,085 (GRCm39) L1451F probably benign Het
Ap1b1 T C 11: 4,990,157 (GRCm39) I860T probably benign Het
Apc G A 18: 34,447,040 (GRCm39) R1312Q possibly damaging Het
Cadps2 A G 6: 23,496,887 (GRCm39) Y453H probably benign Het
Carmil2 A G 8: 106,414,486 (GRCm39) T148A probably benign Het
Ccdc125 A G 13: 100,832,920 (GRCm39) Y499C probably damaging Het
Ccdc14 A G 16: 34,525,288 (GRCm39) M194V possibly damaging Het
Ccdc162 C A 10: 41,506,110 (GRCm39) M893I probably benign Het
Chn2 T A 6: 54,272,840 (GRCm39) Y355N probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Clec4g A G 8: 3,766,500 (GRCm39) M267T probably damaging Het
Clybl G A 14: 122,608,815 (GRCm39) V136I probably damaging Het
Ctnnd1 G T 2: 84,438,682 (GRCm39) Q877K probably benign Het
Derl3 A G 10: 75,729,848 (GRCm39) K94R probably null Het
Dnah2 T C 11: 69,375,155 (GRCm39) E1356G probably benign Het
Dnah5 A C 15: 28,204,054 (GRCm39) probably benign Het
Dusp19 T A 2: 80,461,344 (GRCm39) V211E probably benign Het
Efcab3 T C 11: 104,856,648 (GRCm39) probably null Het
Entpd7 T A 19: 43,692,709 (GRCm39) V88E possibly damaging Het
Fam114a1 T A 5: 65,153,227 (GRCm39) S140T possibly damaging Het
Fbxw13 A G 9: 109,008,382 (GRCm39) F456L probably benign Het
Fpr-rs4 A T 17: 18,242,217 (GRCm39) M75L probably benign Het
Grb14 T G 2: 64,852,985 (GRCm39) T2P probably damaging Het
H2bc21 T C 3: 96,128,681 (GRCm39) V67A probably benign Het
Hace1 T A 10: 45,528,769 (GRCm39) S337T probably benign Het
Heatr5b C T 17: 79,072,831 (GRCm39) V1611I probably benign Het
Ints6 A T 14: 62,934,147 (GRCm39) S787T probably benign Het
Itga9 A G 9: 118,455,536 (GRCm39) K70R probably benign Het
Kcnt2 T C 1: 140,352,933 (GRCm39) I214T probably damaging Het
Kdelr3 C A 15: 79,411,275 (GRCm39) L203I probably benign Het
Kpnb1 A G 11: 97,054,284 (GRCm39) M842T probably benign Het
Lamc1 G T 1: 153,127,746 (GRCm39) R386S probably damaging Het
Lctl A G 9: 64,026,539 (GRCm39) probably benign Het
Lrrn3 G A 12: 41,503,243 (GRCm39) P358L probably damaging Het
Mag T C 7: 30,599,793 (GRCm39) H582R possibly damaging Het
Megf9 A T 4: 70,353,691 (GRCm39) C372S probably damaging Het
Mfsd11 T C 11: 116,750,398 (GRCm39) F139S probably damaging Het
Mpst G T 15: 78,294,642 (GRCm39) V125L probably damaging Het
Myo15b T C 11: 115,775,965 (GRCm39) V587A probably benign Het
Myod1 A T 7: 46,026,356 (GRCm39) H87L probably damaging Het
Oacyl G T 18: 65,858,415 (GRCm39) V247L probably benign Het
Or10ag54 A C 2: 87,099,271 (GRCm39) T49P possibly damaging Het
Or1j4 G A 2: 36,740,565 (GRCm39) C169Y probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or52ab7 T A 7: 102,978,583 (GRCm39) Y297N probably damaging Het
Or52e7 T C 7: 104,684,830 (GRCm39) Y142H probably damaging Het
Or5k14 A G 16: 58,692,748 (GRCm39) L255P probably damaging Het
Or5k17 A T 16: 58,746,271 (GRCm39) I221N probably damaging Het
Or6c6c A G 10: 129,541,283 (GRCm39) T179A probably benign Het
Or8b52 A G 9: 38,576,580 (GRCm39) S187P possibly damaging Het
Or8b57 A C 9: 40,004,112 (GRCm39) I50S possibly damaging Het
Pde3a T C 6: 141,425,202 (GRCm39) F666S probably benign Het
Phf20 G A 2: 156,115,690 (GRCm39) R337H probably benign Het
Plcg2 G A 8: 118,323,107 (GRCm39) E721K probably benign Het
Prkg1 T A 19: 30,549,038 (GRCm39) T646S probably benign Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Prss16 C A 13: 22,191,108 (GRCm39) A206S possibly damaging Het
Prss37 A T 6: 40,491,909 (GRCm39) Y224N probably damaging Het
Ptprt A G 2: 161,417,698 (GRCm39) L926S probably benign Het
Rgl1 G A 1: 152,400,454 (GRCm39) T649I possibly damaging Het
Rgs3 C A 4: 62,559,019 (GRCm39) D504E probably benign Het
Rp1 C T 1: 4,418,488 (GRCm39) A875T probably benign Het
Rpl9-ps1 T A 11: 83,536,177 (GRCm39) K91* probably null Het
Slc44a2 A G 9: 21,253,268 (GRCm39) Y65C probably damaging Het
Snw1 T C 12: 87,505,674 (GRCm39) K255E probably damaging Het
Sox6 T C 7: 115,261,557 (GRCm39) I220V probably benign Het
Stimate T A 14: 30,588,639 (GRCm39) V122E probably damaging Het
Synpo2 A T 3: 122,873,705 (GRCm39) I1146N probably damaging Het
Tas2r115 T C 6: 132,714,472 (GRCm39) R160G probably benign Het
Tchh T C 3: 93,354,051 (GRCm39) F1164L unknown Het
Trim58 T C 11: 58,542,093 (GRCm39) V351A probably damaging Het
Ttf1 T C 2: 28,964,666 (GRCm39) S663P possibly damaging Het
Wdr59 A G 8: 112,177,700 (GRCm39) Y920H Het
Zfp418 A G 7: 7,185,435 (GRCm39) Y466C probably damaging Het
Zfp827 A T 8: 79,844,982 (GRCm39) R717S possibly damaging Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 57,977,257 (GRCm39) splice site probably benign
IGL01403:Ccdc33 APN 9 58,024,668 (GRCm39) missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58,024,919 (GRCm39) splice site probably benign
IGL01714:Ccdc33 APN 9 57,937,153 (GRCm39) missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 57,983,861 (GRCm39) missense probably benign 0.13
IGL02158:Ccdc33 APN 9 57,937,702 (GRCm39) missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 57,940,938 (GRCm39) missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58,005,874 (GRCm39) missense probably benign 0.43
R0276:Ccdc33 UTSW 9 57,965,675 (GRCm39) missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58,024,737 (GRCm39) missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 57,989,331 (GRCm39) missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58,024,497 (GRCm39) splice site probably benign
R0791:Ccdc33 UTSW 9 57,936,046 (GRCm39) missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 57,940,955 (GRCm39) missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58,024,749 (GRCm39) missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58,024,729 (GRCm39) missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 57,939,991 (GRCm39) missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58,024,445 (GRCm39) nonsense probably null
R1982:Ccdc33 UTSW 9 58,024,451 (GRCm39) missense probably benign 0.07
R2044:Ccdc33 UTSW 9 57,938,395 (GRCm39) missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 57,983,913 (GRCm39) missense probably benign 0.44
R3899:Ccdc33 UTSW 9 57,940,200 (GRCm39) missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 57,977,155 (GRCm39) missense possibly damaging 0.67
R4468:Ccdc33 UTSW 9 57,937,235 (GRCm39) missense possibly damaging 0.93
R4703:Ccdc33 UTSW 9 57,940,953 (GRCm39) missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58,024,840 (GRCm39) missense probably benign 0.01
R4790:Ccdc33 UTSW 9 57,937,240 (GRCm39) missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 57,974,818 (GRCm39) missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 57,974,839 (GRCm39) missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 57,977,134 (GRCm39) missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58,025,918 (GRCm39) missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 57,940,267 (GRCm39) missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 57,993,860 (GRCm39) missense probably benign 0.00
R5528:Ccdc33 UTSW 9 57,936,078 (GRCm39) missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58,024,450 (GRCm39) missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 57,937,235 (GRCm39) missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 57,940,489 (GRCm39) splice site probably benign
R5975:Ccdc33 UTSW 9 58,024,761 (GRCm39) missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 57,993,883 (GRCm39) missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58,009,201 (GRCm39) splice site probably null
R6363:Ccdc33 UTSW 9 58,021,618 (GRCm39) missense probably benign 0.00
R6610:Ccdc33 UTSW 9 57,976,419 (GRCm39) missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 57,940,527 (GRCm39) missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58,019,267 (GRCm39) makesense probably null
R7121:Ccdc33 UTSW 9 57,988,167 (GRCm39) missense probably benign 0.00
R7182:Ccdc33 UTSW 9 57,941,456 (GRCm39) splice site probably null
R7239:Ccdc33 UTSW 9 57,940,192 (GRCm39) nonsense probably null
R7655:Ccdc33 UTSW 9 58,025,748 (GRCm39) missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58,025,748 (GRCm39) missense probably damaging 0.97
R7868:Ccdc33 UTSW 9 57,976,374 (GRCm39) missense probably benign
R8215:Ccdc33 UTSW 9 57,939,995 (GRCm39) missense probably benign 0.18
R9139:Ccdc33 UTSW 9 57,983,842 (GRCm39) missense probably benign 0.04
R9204:Ccdc33 UTSW 9 57,938,388 (GRCm39) missense probably benign 0.33
R9280:Ccdc33 UTSW 9 57,965,549 (GRCm39) missense probably benign
R9297:Ccdc33 UTSW 9 57,993,876 (GRCm39) missense possibly damaging 0.85
R9361:Ccdc33 UTSW 9 58,024,908 (GRCm39) missense possibly damaging 0.96
R9664:Ccdc33 UTSW 9 57,993,855 (GRCm39) missense possibly damaging 0.85
RF003:Ccdc33 UTSW 9 57,965,574 (GRCm39) missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58,024,699 (GRCm39) missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58,025,868 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TAAATGCTTTTATCGGAGCCCAG -3'
(R):5'- GCATCCATTAAGCCCAGGAC -3'

Sequencing Primer
(F):5'- CTTTTATCGGAGCCCAGGGAGG -3'
(R):5'- TTAAGCCCAGGACGACATG -3'
Posted On 2022-03-25