Incidental Mutation 'R9318:Hace1'
ID 705979
Institutional Source Beutler Lab
Gene Symbol Hace1
Ensembl Gene ENSMUSG00000038822
Gene Name HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
Synonyms A730034A22Rik, 1700042J16Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.485) question?
Stock # R9318 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 45453925-45588441 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45528769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 337 (S337T)
Ref Sequence ENSEMBL: ENSMUSP00000039206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037044]
AlphaFold Q3U0D9
Predicted Effect probably benign
Transcript: ENSMUST00000037044
AA Change: S337T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039206
Gene: ENSMUSG00000038822
AA Change: S337T

DomainStartEndE-ValueType
ANK 64 93 3.23e-4 SMART
ANK 97 126 7.76e-7 SMART
ANK 130 159 8.26e-2 SMART
ANK 163 192 1.94e-7 SMART
ANK 196 227 1.65e-1 SMART
ANK 228 257 5.98e1 SMART
Blast:HECTc 372 522 7e-87 BLAST
HECTc 572 909 1.76e-138 SMART
Meta Mutation Damage Score 0.0560 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HECT domain and ankyrin repeat-containing ubiquitin ligase. The encoded protein is involved in specific tagging of target proteins, leading to their subcellular localization or proteasomal degradation. The protein is a potential tumor suppressor and is involved in the pathophysiology of several tumors, including Wilm's tumor. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased spontaneous and induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A G 15: 94,301,321 (GRCm39) S68P possibly damaging Het
Adcy6 A T 15: 98,491,466 (GRCm39) N1044K possibly damaging Het
Ak9 T G 10: 41,299,081 (GRCm39) M1594R unknown Het
Angpt1 A G 15: 42,301,751 (GRCm39) I419T probably benign Het
Ankrd31 A T 13: 97,015,085 (GRCm39) L1451F probably benign Het
Ap1b1 T C 11: 4,990,157 (GRCm39) I860T probably benign Het
Apc G A 18: 34,447,040 (GRCm39) R1312Q possibly damaging Het
Cadps2 A G 6: 23,496,887 (GRCm39) Y453H probably benign Het
Carmil2 A G 8: 106,414,486 (GRCm39) T148A probably benign Het
Ccdc125 A G 13: 100,832,920 (GRCm39) Y499C probably damaging Het
Ccdc14 A G 16: 34,525,288 (GRCm39) M194V possibly damaging Het
Ccdc162 C A 10: 41,506,110 (GRCm39) M893I probably benign Het
Ccdc33 C A 9: 57,993,876 (GRCm39) W335L possibly damaging Het
Chn2 T A 6: 54,272,840 (GRCm39) Y355N probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Clec4g A G 8: 3,766,500 (GRCm39) M267T probably damaging Het
Clybl G A 14: 122,608,815 (GRCm39) V136I probably damaging Het
Ctnnd1 G T 2: 84,438,682 (GRCm39) Q877K probably benign Het
Derl3 A G 10: 75,729,848 (GRCm39) K94R probably null Het
Dnah2 T C 11: 69,375,155 (GRCm39) E1356G probably benign Het
Dnah5 A C 15: 28,204,054 (GRCm39) probably benign Het
Dusp19 T A 2: 80,461,344 (GRCm39) V211E probably benign Het
Efcab3 T C 11: 104,856,648 (GRCm39) probably null Het
Entpd7 T A 19: 43,692,709 (GRCm39) V88E possibly damaging Het
Fam114a1 T A 5: 65,153,227 (GRCm39) S140T possibly damaging Het
Fbxw13 A G 9: 109,008,382 (GRCm39) F456L probably benign Het
Fpr-rs4 A T 17: 18,242,217 (GRCm39) M75L probably benign Het
Grb14 T G 2: 64,852,985 (GRCm39) T2P probably damaging Het
H2bc21 T C 3: 96,128,681 (GRCm39) V67A probably benign Het
Heatr5b C T 17: 79,072,831 (GRCm39) V1611I probably benign Het
Ints6 A T 14: 62,934,147 (GRCm39) S787T probably benign Het
Itga9 A G 9: 118,455,536 (GRCm39) K70R probably benign Het
Kcnt2 T C 1: 140,352,933 (GRCm39) I214T probably damaging Het
Kdelr3 C A 15: 79,411,275 (GRCm39) L203I probably benign Het
Kpnb1 A G 11: 97,054,284 (GRCm39) M842T probably benign Het
Lamc1 G T 1: 153,127,746 (GRCm39) R386S probably damaging Het
Lctl A G 9: 64,026,539 (GRCm39) probably benign Het
Lrrn3 G A 12: 41,503,243 (GRCm39) P358L probably damaging Het
Mag T C 7: 30,599,793 (GRCm39) H582R possibly damaging Het
Megf9 A T 4: 70,353,691 (GRCm39) C372S probably damaging Het
Mfsd11 T C 11: 116,750,398 (GRCm39) F139S probably damaging Het
Mpst G T 15: 78,294,642 (GRCm39) V125L probably damaging Het
Myo15b T C 11: 115,775,965 (GRCm39) V587A probably benign Het
Myod1 A T 7: 46,026,356 (GRCm39) H87L probably damaging Het
Oacyl G T 18: 65,858,415 (GRCm39) V247L probably benign Het
Or10ag54 A C 2: 87,099,271 (GRCm39) T49P possibly damaging Het
Or1j4 G A 2: 36,740,565 (GRCm39) C169Y probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or52ab7 T A 7: 102,978,583 (GRCm39) Y297N probably damaging Het
Or52e7 T C 7: 104,684,830 (GRCm39) Y142H probably damaging Het
Or5k14 A G 16: 58,692,748 (GRCm39) L255P probably damaging Het
Or5k17 A T 16: 58,746,271 (GRCm39) I221N probably damaging Het
Or6c6c A G 10: 129,541,283 (GRCm39) T179A probably benign Het
Or8b52 A G 9: 38,576,580 (GRCm39) S187P possibly damaging Het
Or8b57 A C 9: 40,004,112 (GRCm39) I50S possibly damaging Het
Pde3a T C 6: 141,425,202 (GRCm39) F666S probably benign Het
Phf20 G A 2: 156,115,690 (GRCm39) R337H probably benign Het
Plcg2 G A 8: 118,323,107 (GRCm39) E721K probably benign Het
Prkg1 T A 19: 30,549,038 (GRCm39) T646S probably benign Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Prss16 C A 13: 22,191,108 (GRCm39) A206S possibly damaging Het
Prss37 A T 6: 40,491,909 (GRCm39) Y224N probably damaging Het
Ptprt A G 2: 161,417,698 (GRCm39) L926S probably benign Het
Rgl1 G A 1: 152,400,454 (GRCm39) T649I possibly damaging Het
Rgs3 C A 4: 62,559,019 (GRCm39) D504E probably benign Het
Rp1 C T 1: 4,418,488 (GRCm39) A875T probably benign Het
Rpl9-ps1 T A 11: 83,536,177 (GRCm39) K91* probably null Het
Slc44a2 A G 9: 21,253,268 (GRCm39) Y65C probably damaging Het
Snw1 T C 12: 87,505,674 (GRCm39) K255E probably damaging Het
Sox6 T C 7: 115,261,557 (GRCm39) I220V probably benign Het
Stimate T A 14: 30,588,639 (GRCm39) V122E probably damaging Het
Synpo2 A T 3: 122,873,705 (GRCm39) I1146N probably damaging Het
Tas2r115 T C 6: 132,714,472 (GRCm39) R160G probably benign Het
Tchh T C 3: 93,354,051 (GRCm39) F1164L unknown Het
Trim58 T C 11: 58,542,093 (GRCm39) V351A probably damaging Het
Ttf1 T C 2: 28,964,666 (GRCm39) S663P possibly damaging Het
Wdr59 A G 8: 112,177,700 (GRCm39) Y920H Het
Zfp418 A G 7: 7,185,435 (GRCm39) Y466C probably damaging Het
Zfp827 A T 8: 79,844,982 (GRCm39) R717S possibly damaging Het
Other mutations in Hace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Hace1 APN 10 45,548,453 (GRCm39) nonsense probably null
IGL01456:Hace1 APN 10 45,586,094 (GRCm39) splice site probably benign
IGL02122:Hace1 APN 10 45,494,700 (GRCm39) missense probably damaging 1.00
IGL02217:Hace1 APN 10 45,466,471 (GRCm39) splice site probably null
IGL02493:Hace1 APN 10 45,464,515 (GRCm39) missense probably damaging 0.98
IGL02596:Hace1 APN 10 45,576,736 (GRCm39) missense possibly damaging 0.55
IGL02619:Hace1 APN 10 45,547,530 (GRCm39) unclassified probably benign
IGL03163:Hace1 APN 10 45,548,701 (GRCm39) missense probably damaging 0.97
R0609:Hace1 UTSW 10 45,524,965 (GRCm39) missense probably damaging 1.00
R0853:Hace1 UTSW 10 45,524,779 (GRCm39) missense probably damaging 1.00
R2038:Hace1 UTSW 10 45,576,721 (GRCm39) missense probably benign 0.03
R2212:Hace1 UTSW 10 45,524,771 (GRCm39) missense possibly damaging 0.50
R2328:Hace1 UTSW 10 45,525,041 (GRCm39) missense probably benign 0.43
R2881:Hace1 UTSW 10 45,547,230 (GRCm39) missense probably benign 0.10
R3005:Hace1 UTSW 10 45,524,959 (GRCm39) missense probably damaging 0.96
R3414:Hace1 UTSW 10 45,524,771 (GRCm39) missense possibly damaging 0.50
R3930:Hace1 UTSW 10 45,587,604 (GRCm39) missense probably benign 0.37
R4014:Hace1 UTSW 10 45,464,470 (GRCm39) splice site probably benign
R4335:Hace1 UTSW 10 45,586,057 (GRCm39) missense probably damaging 0.99
R4547:Hace1 UTSW 10 45,548,651 (GRCm39) splice site probably null
R4812:Hace1 UTSW 10 45,562,699 (GRCm39) missense probably benign 0.00
R4996:Hace1 UTSW 10 45,526,046 (GRCm39) missense probably benign 0.17
R5858:Hace1 UTSW 10 45,587,621 (GRCm39) missense possibly damaging 0.58
R5995:Hace1 UTSW 10 45,546,487 (GRCm39) missense probably benign 0.00
R6049:Hace1 UTSW 10 45,562,758 (GRCm39) missense probably damaging 1.00
R6111:Hace1 UTSW 10 45,465,606 (GRCm39) missense possibly damaging 0.92
R6195:Hace1 UTSW 10 45,546,539 (GRCm39) missense possibly damaging 0.70
R6216:Hace1 UTSW 10 45,494,643 (GRCm39) missense probably benign
R6233:Hace1 UTSW 10 45,546,539 (GRCm39) missense possibly damaging 0.70
R6237:Hace1 UTSW 10 45,524,986 (GRCm39) missense probably benign
R6467:Hace1 UTSW 10 45,466,362 (GRCm39) critical splice acceptor site probably null
R6930:Hace1 UTSW 10 45,494,598 (GRCm39) missense probably damaging 1.00
R7325:Hace1 UTSW 10 45,465,603 (GRCm39) nonsense probably null
R7401:Hace1 UTSW 10 45,546,722 (GRCm39) missense probably damaging 1.00
R7426:Hace1 UTSW 10 45,481,636 (GRCm39) missense probably damaging 1.00
R7471:Hace1 UTSW 10 45,577,075 (GRCm39) missense probably benign 0.06
R7533:Hace1 UTSW 10 45,587,570 (GRCm39) missense probably benign 0.03
R7661:Hace1 UTSW 10 45,481,649 (GRCm39) missense probably damaging 1.00
R7873:Hace1 UTSW 10 45,548,883 (GRCm39) missense possibly damaging 0.92
R7938:Hace1 UTSW 10 45,562,792 (GRCm39) missense probably benign 0.11
R7995:Hace1 UTSW 10 45,465,588 (GRCm39) missense probably damaging 1.00
R8017:Hace1 UTSW 10 45,514,478 (GRCm39) missense probably damaging 1.00
R8019:Hace1 UTSW 10 45,514,478 (GRCm39) missense probably damaging 1.00
R8022:Hace1 UTSW 10 45,577,066 (GRCm39) missense probably damaging 1.00
R8292:Hace1 UTSW 10 45,587,557 (GRCm39) nonsense probably null
R8717:Hace1 UTSW 10 45,481,694 (GRCm39) missense unknown
R8757:Hace1 UTSW 10 45,546,539 (GRCm39) missense possibly damaging 0.70
R8814:Hace1 UTSW 10 45,528,797 (GRCm39) missense probably damaging 0.99
R8823:Hace1 UTSW 10 45,524,956 (GRCm39) missense probably damaging 1.00
R8898:Hace1 UTSW 10 45,576,766 (GRCm39) missense probably benign 0.01
R9143:Hace1 UTSW 10 45,562,764 (GRCm39) missense probably damaging 0.99
R9297:Hace1 UTSW 10 45,528,769 (GRCm39) missense probably benign 0.00
R9365:Hace1 UTSW 10 45,586,092 (GRCm39) critical splice donor site probably null
R9492:Hace1 UTSW 10 45,547,230 (GRCm39) missense probably benign 0.10
R9644:Hace1 UTSW 10 45,526,001 (GRCm39) missense probably benign 0.01
R9656:Hace1 UTSW 10 45,547,545 (GRCm39) missense probably benign 0.00
R9762:Hace1 UTSW 10 45,525,014 (GRCm39) missense probably benign 0.03
Z1176:Hace1 UTSW 10 45,562,758 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGAGAATTCATGAGACAGTTG -3'
(R):5'- AGCACGAATGGGATTGATTTATGTG -3'

Sequencing Primer
(F):5'- TCATGAGACAGTTGGTTAGTGAAC -3'
(R):5'- TGTTCATTAGACAAAACTGAAAGGG -3'
Posted On 2022-03-25