Incidental Mutation 'R9318:Or6c6c'
ID 705981
Institutional Source Beutler Lab
Gene Symbol Or6c6c
Ensembl Gene ENSMUSG00000095401
Gene Name olfactory receptor family 6 subfamily C member 6C
Synonyms GA_x6K02T2PULF-11383575-11384519, MOR110-7, Olfr804
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R9318 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 129540749-129541693 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129541283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 179 (T179A)
Ref Sequence ENSEMBL: ENSMUSP00000150132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077312] [ENSMUST00000213331]
AlphaFold Q7TRH7
Predicted Effect probably benign
Transcript: ENSMUST00000077312
AA Change: T179A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000076540
Gene: ENSMUSG00000095401
AA Change: T179A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6e-48 PFAM
Pfam:7tm_1 39 288 3.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213331
AA Change: T179A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A G 15: 94,301,321 (GRCm39) S68P possibly damaging Het
Adcy6 A T 15: 98,491,466 (GRCm39) N1044K possibly damaging Het
Ak9 T G 10: 41,299,081 (GRCm39) M1594R unknown Het
Angpt1 A G 15: 42,301,751 (GRCm39) I419T probably benign Het
Ankrd31 A T 13: 97,015,085 (GRCm39) L1451F probably benign Het
Ap1b1 T C 11: 4,990,157 (GRCm39) I860T probably benign Het
Apc G A 18: 34,447,040 (GRCm39) R1312Q possibly damaging Het
Cadps2 A G 6: 23,496,887 (GRCm39) Y453H probably benign Het
Carmil2 A G 8: 106,414,486 (GRCm39) T148A probably benign Het
Ccdc125 A G 13: 100,832,920 (GRCm39) Y499C probably damaging Het
Ccdc14 A G 16: 34,525,288 (GRCm39) M194V possibly damaging Het
Ccdc162 C A 10: 41,506,110 (GRCm39) M893I probably benign Het
Ccdc33 C A 9: 57,993,876 (GRCm39) W335L possibly damaging Het
Chn2 T A 6: 54,272,840 (GRCm39) Y355N probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Clec4g A G 8: 3,766,500 (GRCm39) M267T probably damaging Het
Clybl G A 14: 122,608,815 (GRCm39) V136I probably damaging Het
Ctnnd1 G T 2: 84,438,682 (GRCm39) Q877K probably benign Het
Derl3 A G 10: 75,729,848 (GRCm39) K94R probably null Het
Dnah2 T C 11: 69,375,155 (GRCm39) E1356G probably benign Het
Dnah5 A C 15: 28,204,054 (GRCm39) probably benign Het
Dusp19 T A 2: 80,461,344 (GRCm39) V211E probably benign Het
Efcab3 T C 11: 104,856,648 (GRCm39) probably null Het
Entpd7 T A 19: 43,692,709 (GRCm39) V88E possibly damaging Het
Fam114a1 T A 5: 65,153,227 (GRCm39) S140T possibly damaging Het
Fbxw13 A G 9: 109,008,382 (GRCm39) F456L probably benign Het
Fpr-rs4 A T 17: 18,242,217 (GRCm39) M75L probably benign Het
Grb14 T G 2: 64,852,985 (GRCm39) T2P probably damaging Het
H2bc21 T C 3: 96,128,681 (GRCm39) V67A probably benign Het
Hace1 T A 10: 45,528,769 (GRCm39) S337T probably benign Het
Heatr5b C T 17: 79,072,831 (GRCm39) V1611I probably benign Het
Ints6 A T 14: 62,934,147 (GRCm39) S787T probably benign Het
Itga9 A G 9: 118,455,536 (GRCm39) K70R probably benign Het
Kcnt2 T C 1: 140,352,933 (GRCm39) I214T probably damaging Het
Kdelr3 C A 15: 79,411,275 (GRCm39) L203I probably benign Het
Kpnb1 A G 11: 97,054,284 (GRCm39) M842T probably benign Het
Lamc1 G T 1: 153,127,746 (GRCm39) R386S probably damaging Het
Lctl A G 9: 64,026,539 (GRCm39) probably benign Het
Lrrn3 G A 12: 41,503,243 (GRCm39) P358L probably damaging Het
Mag T C 7: 30,599,793 (GRCm39) H582R possibly damaging Het
Megf9 A T 4: 70,353,691 (GRCm39) C372S probably damaging Het
Mfsd11 T C 11: 116,750,398 (GRCm39) F139S probably damaging Het
Mpst G T 15: 78,294,642 (GRCm39) V125L probably damaging Het
Myo15b T C 11: 115,775,965 (GRCm39) V587A probably benign Het
Myod1 A T 7: 46,026,356 (GRCm39) H87L probably damaging Het
Oacyl G T 18: 65,858,415 (GRCm39) V247L probably benign Het
Or10ag54 A C 2: 87,099,271 (GRCm39) T49P possibly damaging Het
Or1j4 G A 2: 36,740,565 (GRCm39) C169Y probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or52ab7 T A 7: 102,978,583 (GRCm39) Y297N probably damaging Het
Or52e7 T C 7: 104,684,830 (GRCm39) Y142H probably damaging Het
Or5k14 A G 16: 58,692,748 (GRCm39) L255P probably damaging Het
Or5k17 A T 16: 58,746,271 (GRCm39) I221N probably damaging Het
Or8b52 A G 9: 38,576,580 (GRCm39) S187P possibly damaging Het
Or8b57 A C 9: 40,004,112 (GRCm39) I50S possibly damaging Het
Pde3a T C 6: 141,425,202 (GRCm39) F666S probably benign Het
Phf20 G A 2: 156,115,690 (GRCm39) R337H probably benign Het
Plcg2 G A 8: 118,323,107 (GRCm39) E721K probably benign Het
Prkg1 T A 19: 30,549,038 (GRCm39) T646S probably benign Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Prss16 C A 13: 22,191,108 (GRCm39) A206S possibly damaging Het
Prss37 A T 6: 40,491,909 (GRCm39) Y224N probably damaging Het
Ptprt A G 2: 161,417,698 (GRCm39) L926S probably benign Het
Rgl1 G A 1: 152,400,454 (GRCm39) T649I possibly damaging Het
Rgs3 C A 4: 62,559,019 (GRCm39) D504E probably benign Het
Rp1 C T 1: 4,418,488 (GRCm39) A875T probably benign Het
Rpl9-ps1 T A 11: 83,536,177 (GRCm39) K91* probably null Het
Slc44a2 A G 9: 21,253,268 (GRCm39) Y65C probably damaging Het
Snw1 T C 12: 87,505,674 (GRCm39) K255E probably damaging Het
Sox6 T C 7: 115,261,557 (GRCm39) I220V probably benign Het
Stimate T A 14: 30,588,639 (GRCm39) V122E probably damaging Het
Synpo2 A T 3: 122,873,705 (GRCm39) I1146N probably damaging Het
Tas2r115 T C 6: 132,714,472 (GRCm39) R160G probably benign Het
Tchh T C 3: 93,354,051 (GRCm39) F1164L unknown Het
Trim58 T C 11: 58,542,093 (GRCm39) V351A probably damaging Het
Ttf1 T C 2: 28,964,666 (GRCm39) S663P possibly damaging Het
Wdr59 A G 8: 112,177,700 (GRCm39) Y920H Het
Zfp418 A G 7: 7,185,435 (GRCm39) Y466C probably damaging Het
Zfp827 A T 8: 79,844,982 (GRCm39) R717S possibly damaging Het
Other mutations in Or6c6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Or6c6c APN 10 129,541,492 (GRCm39) missense probably benign 0.01
IGL02041:Or6c6c APN 10 129,541,104 (GRCm39) missense probably damaging 1.00
IGL02245:Or6c6c APN 10 129,541,608 (GRCm39) missense probably damaging 1.00
IGL02341:Or6c6c APN 10 129,541,358 (GRCm39) missense probably damaging 0.99
IGL02433:Or6c6c APN 10 129,541,445 (GRCm39) missense probably benign 0.01
authen UTSW 10 129,541,668 (GRCm39) missense probably benign 0.00
R0111:Or6c6c UTSW 10 129,541,146 (GRCm39) missense probably damaging 1.00
R0309:Or6c6c UTSW 10 129,541,008 (GRCm39) missense probably benign 0.38
R0326:Or6c6c UTSW 10 129,541,638 (GRCm39) missense possibly damaging 0.69
R0374:Or6c6c UTSW 10 129,541,516 (GRCm39) missense probably benign 0.00
R1573:Or6c6c UTSW 10 129,541,487 (GRCm39) missense probably damaging 1.00
R1663:Or6c6c UTSW 10 129,541,160 (GRCm39) missense probably benign 0.44
R1778:Or6c6c UTSW 10 129,541,574 (GRCm39) missense probably benign 0.01
R1789:Or6c6c UTSW 10 129,541,476 (GRCm39) missense possibly damaging 0.82
R1906:Or6c6c UTSW 10 129,541,365 (GRCm39) missense probably benign 0.00
R2108:Or6c6c UTSW 10 129,541,490 (GRCm39) missense probably benign
R2211:Or6c6c UTSW 10 129,541,320 (GRCm39) missense probably benign
R2432:Or6c6c UTSW 10 129,540,794 (GRCm39) missense possibly damaging 0.91
R2902:Or6c6c UTSW 10 129,541,320 (GRCm39) missense probably benign
R4114:Or6c6c UTSW 10 129,541,668 (GRCm39) missense probably benign 0.00
R5149:Or6c6c UTSW 10 129,541,377 (GRCm39) missense probably benign 0.00
R5153:Or6c6c UTSW 10 129,541,026 (GRCm39) missense probably benign 0.05
R5846:Or6c6c UTSW 10 129,540,756 (GRCm39) missense probably damaging 0.99
R6553:Or6c6c UTSW 10 129,540,932 (GRCm39) missense probably benign 0.07
R7676:Or6c6c UTSW 10 129,541,155 (GRCm39) missense possibly damaging 0.63
R8161:Or6c6c UTSW 10 129,540,753 (GRCm39) missense possibly damaging 0.94
R9266:Or6c6c UTSW 10 129,541,547 (GRCm39) missense probably benign 0.17
R9334:Or6c6c UTSW 10 129,541,683 (GRCm39) missense probably benign 0.00
R9746:Or6c6c UTSW 10 129,541,208 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGCTGCCATGTCCTATGAC -3'
(R):5'- ACAACAATCATGTGGGAAGTGC -3'

Sequencing Primer
(F):5'- GCCATGTCCTATGACCGCTATG -3'
(R):5'- CAATCATGTGGGAAGTGCAGGTG -3'
Posted On 2022-03-25